View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7706_low_17 (Length: 299)
Name: NF7706_low_17
Description: NF7706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7706_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 13 - 283
Target Start/End: Original strand, 48998779 - 48999049
Alignment:
| Q |
13 |
ctgtgattgcatccttaacggcacttatagcttttctaccctcaggactcgacaccaaattgctcagaattgaaaggactctctcactcacttccatatc |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48998779 |
ctgtgattgcatccttaacagcacttatagcttttctaccctcaggactcgacaccaaattgctcagaattgaaaggactctctcactcacttccatatc |
48998878 |
T |
 |
| Q |
113 |
ttctatcgagtttatcaaaaacgcgaccaaatcagtttccaaaacaaatgaaatattcgtctgattgatcgatagattgtaaagagcccgaagagcatct |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48998879 |
ttctatcgagtttatcaaaaacacgaccaaatcagtttccaaaacaaatgaaatattcgtctgattgatcgatagattgtaaagagcccgaagagcatct |
48998978 |
T |
 |
| Q |
213 |
tgtttaacttgagagctacttttactactattatctaaatttttcaggatcctaactaggaagggtattgc |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48998979 |
tgtttaacttgagagctacttttactactattatctaaatttttcaggatcctaactaggaagggtattgc |
48999049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University