View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7706_low_22 (Length: 244)
Name: NF7706_low_22
Description: NF7706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7706_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 15 - 92
Target Start/End: Original strand, 11283445 - 11283520
Alignment:
| Q |
15 |
aatattgtctttgtgtttatatctcttcaaatatagtaagatagtctttttatatattatactaatatttgtcttgcg |
92 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
11283445 |
aatattgcctttgtgtttatatctcttcaaatatagtaagatagtctttttatgtat--tactaatatttgtcttgcg |
11283520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University