View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7706_low_27 (Length: 224)
Name: NF7706_low_27
Description: NF7706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7706_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 47705710 - 47705914
Alignment:
| Q |
11 |
tctctctcgaccaccaccgcaactgaaccatacaccggctatgtttccggcgacgataccattccctgtcgcttcctcttccgctgctttcctcttccgt |
110 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||| |||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47705710 |
tctctctttaccaccaccgcaactgaaccaaacatcggctatgtttctggcgatgataccattccttgtcgcttcctcttccgctgctttcctcttccgt |
47705809 |
T |
|
| Q |
111 |
tttcgaagacgaccctgttctctacctcacacgtttccggcgaggacgccgacaaatctcatctacaacttattctctatttcattatggtctccctctt |
210 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705810 |
tttcgaagacg-ccctgttctctacctcatacgtttccggcgaggacgccgacaaatctcatctacaacttattctctatttcattatggtctccctctt |
47705908 |
T |
|
| Q |
211 |
catctc |
216 |
Q |
| |
|
|||||| |
|
|
| T |
47705909 |
catctc |
47705914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 11 - 216
Target Start/End: Complemental strand, 39843685 - 39843461
Alignment:
| Q |
11 |
tctctctcgaccaccaccgcaactgaaccatacaccggctatgtttccggcgacgataccattccctgtcgcttcctcttccgctgc------------- |
97 |
Q |
| |
|
||||||| |||||||||||||||||| || |||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39843685 |
tctctctttaccaccaccgcaactgaatcaaacaccgactatgtttccggcgacgataccattccctgccgcttcctcttccgctgccgacgacgtcgtc |
39843586 |
T |
|
| Q |
98 |
------tttcctcttccgttttcgaagacgaccctgttctctacctcacacgtttccggcgaggacgccgacaaatctcatctacaacttattctctatt |
191 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39843585 |
cgctgctttcctcttccgttttcgaagacgaccatgttctctacctcacacgtttccggcgaggacgccgacaaatctcatctacaacttattctctatt |
39843486 |
T |
|
| Q |
192 |
tcattatggtctccctcttcatctc |
216 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
39843485 |
tcattatggcctccctcttcatctc |
39843461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University