View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7706_low_28 (Length: 219)
Name: NF7706_low_28
Description: NF7706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7706_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 1056505 - 1056705
Alignment:
| Q |
1 |
gaaagacttattacataaacgaagttcactgtgggttgatgaagctgaactcgagaaggaaatcacaaatgttgtaattgctacaacatatctttgaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1056505 |
gaaagacttattacataaacgaagttcactgtgggttgatgaagctgaactcgagaaggaaatcacaaatgttgtaattgctacaacatatctttgaacc |
1056604 |
T |
 |
| Q |
101 |
cctcgcagtttcatatctctactggttagtagaattttgtcctatgttcaaagaagcctcagaaataattattgcatctagagtatcatatttgtgctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1056605 |
cctcgcagtttcatatctctactggttagtagaattttgtcctatgttcaaagaagcctcagaaataattattgcatctagagtatcatatttgtgctta |
1056704 |
T |
 |
| Q |
201 |
g |
201 |
Q |
| |
|
| |
|
|
| T |
1056705 |
g |
1056705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 8186365 - 8186269
Alignment:
| Q |
1 |
gaaagacttattacataaacgaagttcactgtgggttgatgaagctgaactcgagaaggaaatcacaaatgttgtaattgctacaacatatctttga |
97 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
8186365 |
gaaagagttattgcataaacgaagttcactgtgggttgatgaagccgaactcgagaaggaaataacgaatgttgtaattgctacaacatatctttga |
8186269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University