View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_high_37 (Length: 250)
Name: NF7708A_high_37
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 16 - 137
Target Start/End: Original strand, 51340351 - 51340472
Alignment:
| Q |
16 |
ataggtcttgtatgtacacaacattcagtattcgattaacgtctatcaaatacatcctttcgtcaaatccaaatattaaatatgatggtcgatggcatgc |
115 |
Q |
| |
|
|||||| |||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51340351 |
ataggttttgtatgtacgcaacattcaatattcgattaacgtctatcaaatgcatcctttcgtcaaatccaaatattaaatataatggtcgatggcatgc |
51340450 |
T |
 |
| Q |
116 |
aatcttaaatgatgatgtggta |
137 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
51340451 |
aatcttaaatgatgatgtggta |
51340472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 177 - 250
Target Start/End: Original strand, 51340480 - 51340552
Alignment:
| Q |
177 |
tcatagctaaaaattttggcaataaaaagtgatcatagtt-gctttccgaatatttttattctgaaatttcttat |
250 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
51340480 |
tcatagctaaaaaatttggcaataaaaagtga--atagtttgctttccgaatatttttactctgaaatttcttat |
51340552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University