View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7708A_low_10 (Length: 472)

Name: NF7708A_low_10
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7708A_low_10
NF7708A_low_10
[»] chr3 (2 HSPs)
chr3 (67-191)||(45123478-45123601)
chr3 (284-320)||(45123386-45123421)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 3e-40; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 67 - 191
Target Start/End: Complemental strand, 45123601 - 45123478
Alignment:
67 gtccacacttcttcagaaaacaaatagccaaaacactgtgtctcatcctaaccgaccatttcttttgactcacccaaccaaccaccactgcctcaacttt 166  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||  ||||  |  ||||||||||    
45123601 gtccacccttcttcagaaaacaaatagccaaaacactgtgtctcatcccaaccgaccttttcttttgactcacccaacct-ccactgcatcctcaacttt 45123503  T
167 tctagtttaaattctactcttcctt 191  Q
    |||||||||||||||||||||||||    
45123502 tctagtttaaattctactcttcctt 45123478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 284 - 320
Target Start/End: Complemental strand, 45123421 - 45123386
Alignment:
284 aaatattattcaataaataataaacactatcatagta 320  Q
    ||||||||||||||||||||| |||||||||||||||    
45123421 aaatattattcaataaataat-aacactatcatagta 45123386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University