View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_10 (Length: 472)
Name: NF7708A_low_10
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 3e-40; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 67 - 191
Target Start/End: Complemental strand, 45123601 - 45123478
Alignment:
| Q |
67 |
gtccacacttcttcagaaaacaaatagccaaaacactgtgtctcatcctaaccgaccatttcttttgactcacccaaccaaccaccactgcctcaacttt |
166 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||| | |||||||||| |
|
|
| T |
45123601 |
gtccacccttcttcagaaaacaaatagccaaaacactgtgtctcatcccaaccgaccttttcttttgactcacccaacct-ccactgcatcctcaacttt |
45123503 |
T |
 |
| Q |
167 |
tctagtttaaattctactcttcctt |
191 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45123502 |
tctagtttaaattctactcttcctt |
45123478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 284 - 320
Target Start/End: Complemental strand, 45123421 - 45123386
Alignment:
| Q |
284 |
aaatattattcaataaataataaacactatcatagta |
320 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45123421 |
aaatattattcaataaataat-aacactatcatagta |
45123386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University