View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_115 (Length: 287)
Name: NF7708A_low_115
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_115 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 275
Target Start/End: Complemental strand, 22124583 - 22124319
Alignment:
| Q |
11 |
tttcttattccaaaatagnnnnnnngtcaaagtaaaaacaaggtcttaaaattcttgatagggaagctttcataacatgatgttgcactcataatacatt |
110 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22124583 |
tttcttattccaaaatagaaaagaagtcaaagtaaaaacaaggtcttaaaattcttgatagggaagctttcataacatgatgttgcatacataatacatt |
22124484 |
T |
|
| Q |
111 |
acatacaactcaaatatcaaatccaaaccaaaataataagaaagataaaacattcttttttacagagtaatggaagtgccgacgtccctttggagaatcg |
210 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22124483 |
acacacaactcaaatatcaaatccaaaccaaaataataagaaagacaaaacattcttttttatagagtaatggaagtgctgacgtccctttggagaatcg |
22124384 |
T |
|
| Q |
211 |
gaattgtcattgcacttgaagcctagcacctaccaaatcacaacaaattattcattatacatttt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22124383 |
gaattgtcattgcacttgaagcctagcacctaccaaatcacaacaaattattcattatacatttt |
22124319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University