View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_124 (Length: 277)
Name: NF7708A_low_124
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_124 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 11 - 271
Target Start/End: Original strand, 38643184 - 38643444
Alignment:
| Q |
11 |
atgaaatagtgagtagtagtattttagtaattcaacagaaacacaaggcttcttaaatataaatcacatgttaccatagctggcagcatatgaatcctac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38643184 |
atgaaatagtgagtagtagtattttagtaattcaacaaaaacacaaggcttcttaaatataaatcacatgttaccatagctggcagcatatgaatcctac |
38643283 |
T |
 |
| Q |
111 |
attctcatccactgagcctgtcataaaagctagtacttagttgttagtttgcctctgctagttgccattattcacatttcactcaactctccccaagaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38643284 |
attctcatccactgagcctgtcataaaagctagtacttagttgttagtttgcctctgctagttgccattattcacatttcactcaactcaccccaagaat |
38643383 |
T |
 |
| Q |
211 |
aatggaacatagaagaaactcatcgtggtttcttctattctcaactctttcttgtcttttt |
271 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38643384 |
aatggaacatagaagaaactcatcatggtttcttctattctcaactctttcttgtcttttt |
38643444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University