View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_154 (Length: 252)
Name: NF7708A_low_154
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_154 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 4 - 122
Target Start/End: Original strand, 24130127 - 24130246
Alignment:
| Q |
4 |
aatatatcaaagaaataaaaattagatttcaaggacaaatactgtcattgtaaatcaactttacac-taaattcaatgaaagtgtgtcattttacggcat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||| |
|
|
| T |
24130127 |
aatatatcaaagaaataaaaattagatttcaaggacaaatactgtcattgtaaatcaactttacacttaaatccaatgaaagtgtgtcgttttacggcat |
24130226 |
T |
|
| Q |
103 |
caccttactttcgtaactta |
122 |
Q |
| |
|
| ||||||||| |||||||| |
|
|
| T |
24130227 |
cgccttacttttgtaactta |
24130246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 119 - 215
Target Start/End: Original strand, 24130882 - 24130978
Alignment:
| Q |
119 |
cttataagcaaggtcccgtaagtacaactgaaatactaagtgcatggacattagatacatgttggggagttcatgggtcaagcgaaaaacaacacaa |
215 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24130882 |
cttataaacaaggtcccgtaagtacaactgaaatactaagtgcatggacattagatacatgttggggagttcatgggtcaagcgacaaacaacacaa |
24130978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University