View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_164 (Length: 250)
Name: NF7708A_low_164
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_164 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 165 - 245
Target Start/End: Original strand, 50422786 - 50422866
Alignment:
| Q |
165 |
accattagtctcttctatatatgcttatttttagcttatnnnnnnntcgctagatcataaaattttgttcgaacaccaaac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
50422786 |
accattagtctcttctatatatgcttatttttagcttataaaaaaatcgctagatcataaaattttgttcgaacacaaaac |
50422866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University