View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_171 (Length: 248)
Name: NF7708A_low_171
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_171 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 40688440 - 40688199
Alignment:
| Q |
1 |
tagagtcagtcataaaggatctaacatattgaatgatgggagcataaggatgaatgtatataggattattccttacactcagattctatcagattggaga |
100 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40688440 |
tagaggcattcataaaggatctaacatattgaatgatgggagcataaggatgagtgtatataggattattccttacactcagattctatcagattggaga |
40688341 |
T |
|
| Q |
101 |
tagtcttgcagttagattcacaaatggcttccttaaaaccgttactccaatatcccaagtgatcaaaaccaaactatgagcaaaattgcatgtaattcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
40688340 |
tagtcttgcagttagattcacaaatggcttccttaaaaccgttactccaatatcccaagtgatcagaaccaaactatgagcaaaattgcatgtaattcaa |
40688241 |
T |
|
| Q |
201 |
catcgatattataagtatagtcaataacctaatattcttgga |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40688240 |
catcgatattataagtatagtcaataacctaatattattgga |
40688199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University