View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_180 (Length: 246)
Name: NF7708A_low_180
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_180 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 21 - 246
Target Start/End: Complemental strand, 37880841 - 37880616
Alignment:
| Q |
21 |
cagtatgggatatgaatcagttatatcgactacgcctttatcgacgacaccaactccatcaccaacttatgtgaatagctgcacagaggaagagagggat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37880841 |
cagtatgggatatgaatcagttatatcgactacgcctttatcgacgacaccaactccatcaccaacttatgtgaatagctgcacagaggaagagagggat |
37880742 |
T |
 |
| Q |
121 |
acatattgcagtgacatattcaagttcgaaattccggagagtactttggatattaatgatttcttgtaaatgtgtgtatatacgattgcaaactttgttc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37880741 |
acatattgcagtgacatattcaagttcgaaattccggagagtactttggatattaatgatttcttgtaaatgtgtgtatatacgattgcagactttgttt |
37880642 |
T |
 |
| Q |
221 |
aatatgcacaagtaatatagttttgt |
246 |
Q |
| |
|
|||||| |||||||| |||||||||| |
|
|
| T |
37880641 |
aatatgaacaagtaagatagttttgt |
37880616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University