View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_185 (Length: 245)
Name: NF7708A_low_185
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_185 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 236
Target Start/End: Original strand, 1841338 - 1841564
Alignment:
| Q |
7 |
acactgtgaactgcttctacctctcttcactctattttgttgatttattttcatttcactcttttgattactgtcatggctacggttattattcttataa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||| |
|
|
| T |
1841338 |
acactgtgaactgcttctacctctcttcactccattttgttgatttattttcatttcactcttttgattactttcatggctacgtttat---tcttataa |
1841434 |
T |
|
| Q |
107 |
ttaggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtctttggagaagaacttctccgaggaacctttttcgatttcaaaccttgtt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1841435 |
ttaggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtctttggagaagaacttctccgaggaacctttttcgatttcaaaccatgtt |
1841534 |
T |
|
| Q |
207 |
cttgttcttgctcttgtggttgatattgtt |
236 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| |
|
|
| T |
1841535 |
cttgttcttgttcttgtggttgatgttgtt |
1841564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 110 - 236
Target Start/End: Original strand, 1824138 - 1824264
Alignment:
| Q |
110 |
ggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtctttggagaagaacttctccgaggaacctttttcgatttcaaaccttgttctt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||| || |
|
|
| T |
1824138 |
ggtgtagctggtatcatagttgaattatcaaaagacaaaatatatgtctttggagaagaacttttacgaggaacctttttcgatttcaaaccatgttgtt |
1824237 |
T |
|
| Q |
210 |
gttcttgctcttgtggttgatattgtt |
236 |
Q |
| |
|
||||||| ||||||||||||| ||||| |
|
|
| T |
1824238 |
gttcttgttcttgtggttgatgttgtt |
1824264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University