View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7708A_low_204 (Length: 241)

Name: NF7708A_low_204
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7708A_low_204
NF7708A_low_204
[»] chr2 (2 HSPs)
chr2 (146-241)||(31658583-31658678)
chr2 (7-44)||(31658521-31658558)


Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 146 - 241
Target Start/End: Original strand, 31658583 - 31658678
Alignment:
146 ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaat 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31658583 ccaatgccaaactttgaaaataaatttacacttagacagaaacatatccatagccatcaaaatcctaactggtcataaacattctcaaattcaaat 31658678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 44
Target Start/End: Original strand, 31658521 - 31658558
Alignment:
7 gacatcataagttaaacgatcaaataaatctcccatta 44  Q
    ||||||||||||||||||||||||||||||||||||||    
31658521 gacatcataagttaaacgatcaaataaatctcccatta 31658558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University