View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7708A_low_207 (Length: 240)

Name: NF7708A_low_207
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7708A_low_207
NF7708A_low_207
[»] chr2 (1 HSPs)
chr2 (1-234)||(35449819-35450052)
[»] chr4 (1 HSPs)
chr4 (2-70)||(21010633-21010701)


Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 35449819 - 35450052
Alignment:
1 tagagaaagagatgaagcacaagaaaaaagtgaaagacttctcttggaaaagctaggtttccagcaacaacaaaatgctccactatccggagtttcaagc 100  Q
    |||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||||| ||||||||||||| |||||| |||||||||||||||    
35449819 tagagaaagagatgaagcacaagaaaaatgtcaaagacttctcttggaaaagctagttttccatcaacaacaaaatgatccactttccggagtttcaagc 35449918  T
101 attgaagatgaacaagttacaagaaaaggaattgactcaaacaatggtttttctttgtcttcatcagattgtgaagaaagcattgtttcttcaccaatta 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
35449919 attgaagatgaacaagttacaagaaaaggaattgactcaaacaatggtttttctttgtcttcttcagattgtgaagaaagcattgtttcttcaccaatta 35450018  T
201 ttgatcaatcaatgattgaagtactaacaccaaa 234  Q
    ||||||||||||||||||||||||||||||||||    
35450019 ttgatcaatcaatgattgaagtactaacaccaaa 35450052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 70
Target Start/End: Complemental strand, 21010701 - 21010633
Alignment:
2 agagaaagagatgaagcacaagaaaaaagtgaaagacttctcttggaaaagctaggtttccagcaacaa 70  Q
    ||||||||||||||||||||||||||| |  |||||||| |||| |||||| ||  |||||| ||||||    
21010701 agagaaagagatgaagcacaagaaaaatgccaaagacttttcttagaaaagttacttttccaacaacaa 21010633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University