View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_215 (Length: 238)
Name: NF7708A_low_215
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_215 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 14 - 221
Target Start/End: Complemental strand, 22362307 - 22362097
Alignment:
| Q |
14 |
gattattctccgctcaaaatacctgatatcagtgtttttcacgtcaatctcaccgcggtatgcaaacaaacaagaccctacatatgttaaccatgatct- |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| | |
|
|
| T |
22362307 |
gattattctccgctcaaaatacctgatatcggtgtttttcacgtcaatctcaccgcggtatgcaaacaaacaagaccttacatattttaaccatgatatt |
22362208 |
T |
|
| Q |
113 |
--tgctgggttcttattcatcttttctttttcctgcgttgtgtatgttagggatctatgatggcaccacatgtgcatcccagtgcaacagattataccat |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| |||||||||||||||||| |||||||||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
22362207 |
gctgctgggttcttattcatcttttctatttcatgcattgtgtatgttagggatcaatgatggcaccacatgtgaatccaagtgcaacagagtataccat |
22362108 |
T |
|
| Q |
211 |
agtagtaagag |
221 |
Q |
| |
|
|||| |||||| |
|
|
| T |
22362107 |
agtattaagag |
22362097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University