View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_237 (Length: 230)
Name: NF7708A_low_237
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_237 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 30267825 - 30267636
Alignment:
| Q |
1 |
aaactttacaaagaggggaacaactattttattgctggaaattagcatagctattagctcttatctacctcttccttttgaaccaaaatctaaatcttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30267825 |
aaactttacaaagaggggaacaactattttattgctggaaattagcatagctattagctcttatctacctcttccttttgaaccaaaatctaaatcttac |
30267726 |
T |
|
| Q |
101 |
caaacaaaacttgggcagtgtcattatggtttaaatcttactagcaatagaaacagtgtgaaatgccaaattgggtattggtatttggta |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30267725 |
caaacaaaacttgggcagtgtcattatggtttaaatcttactagcagtagaaacagtgtgaaatgccaaattgggtattggtatttggta |
30267636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 23 - 224
Target Start/End: Original strand, 29364757 - 29364957
Alignment:
| Q |
23 |
actattttattgctggaaattagcatagctattagctcttatctacctcttccttttgaaccaaaatctaaatcttaccaaacaaaacttgggcagtgtc |
122 |
Q |
| |
|
||||||||||||||||||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| | |
|
|
| T |
29364757 |
actattttattgctggaaatttgca-agttattagctcttatctacctcttccttttgaaccaaaatctaaatcttaccaaaaaaaacttgggtggtggc |
29364855 |
T |
|
| Q |
123 |
attatggtttaaatcttactagcaatagaaacagtgtgaaatgccaaattgggtattggtatttggtagttatcaacaaagtattttgggttatctatac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29364856 |
attatggtttaaatcttactagcaatagaaacagtgtgaaatgccaaatggggtattggtatttggtagttatcaacaaagtattttattttatctatac |
29364955 |
T |
|
| Q |
223 |
ct |
224 |
Q |
| |
|
|| |
|
|
| T |
29364956 |
ct |
29364957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University