View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_268 (Length: 222)
Name: NF7708A_low_268
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_268 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 5034752 - 5034530
Alignment:
| Q |
1 |
tattatcaaacttgtgtctagtagatgttcgtttgttactcaatctgt-tttatgtgcttagaatgttaataattattcaaaatcttttaccagttttat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5034752 |
tattatcaaacttgtgtctagtagatgttcgtttgttactcaatcttcctttatgtgcttagaatgttaataattattcaaagtcttttaccagttttat |
5034653 |
T |
 |
| Q |
100 |
gtttaacattcaacacatctttttaatttggttgaatctccgaatatctatttcattcattttgatatgaaattagaaacttctccaagcatggtgaaat |
199 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5034652 |
gtttaacattcaatacatctttttaatttggttgaatctcctgatatctatttcattcatattgatgtgaaattagaaacttctccaagcatggtgaaat |
5034553 |
T |
 |
| Q |
200 |
agtcattgttcatgacttaacac |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5034552 |
agtcattgttcatgacttaacac |
5034530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 133 - 210
Target Start/End: Complemental strand, 2489483 - 2489406
Alignment:
| Q |
133 |
gaatctccgaatatctatttcattcattttgatatgaaattagaaacttctccaagcatggtgaaatagtcattgttc |
210 |
Q |
| |
|
||||||| |||||||||||||||||||||||| | |||||||||||||||| |||| ||||||||| |||||||||| |
|
|
| T |
2489483 |
gaatctctaaatatctatttcattcattttgattttaaattagaaacttctcgaagcctggtgaaatggtcattgttc |
2489406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University