View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_269 (Length: 221)
Name: NF7708A_low_269
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_269 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 21 - 217
Target Start/End: Complemental strand, 13753218 - 13753017
Alignment:
| Q |
21 |
tataggaaacacagaactaaacaatcactaatctttcaaatttt-----tagtatgagttccttgaagaaatagaaatttccttaacttggaatgtgtgt |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
13753218 |
tataggaaacacataactaaacaatcactaatctttcaaattttggttatagtatgagttccttgaataaatagaaatttccttaacttgaaatgtgtgt |
13753119 |
T |
 |
| Q |
116 |
gattttacttgatagaaacaagcatcaatttataaattattttgatatatataaatacatcaaagtttacacactcataatgtaataggaagtaacatct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
13753118 |
gattttacttgatagaaacaagcatcaatttataaattattttgatacatataagtacatcaaagtctacacactcataatgtaatagaaagtaacatct |
13753019 |
T |
 |
| Q |
216 |
tc |
217 |
Q |
| |
|
|| |
|
|
| T |
13753018 |
tc |
13753017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University