View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_270 (Length: 221)
Name: NF7708A_low_270
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_270 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 92 - 204
Target Start/End: Original strand, 42590891 - 42591004
Alignment:
| Q |
92 |
taatggcaatcatattgggtagtgagcatagtggtgataacagaattgaagaagggcattc-cctatggaatagtgtggttaaagataatttctaactgt |
190 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
42590891 |
taatggcagtcatgttgggtagtgagcatagtggtgataacagaattgaagaagggccttctcctatggaatagtgtggttgaagataatttctaaccgt |
42590990 |
T |
 |
| Q |
191 |
aatacatgctggtg |
204 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
42590991 |
aatacaagctggtg |
42591004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University