View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_272 (Length: 219)
Name: NF7708A_low_272
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_272 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 13753386 - 13753586
Alignment:
| Q |
1 |
aatatgaacagaagttaattgaggagggggatgcgtggaacatgatacactaaaatctgggaacaaagaaaattcgtcttatgatttttctgtaataaag |
100 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13753386 |
aatatgatcagaagttatttgaggagggg-atgctttgaacatgatacactaaaatctgggaacaaagaaaattcgtcttatgatttttctgtaataaag |
13753484 |
T |
 |
| Q |
101 |
attggaaatcattatggaatttgtatggtgcctttggttttgagctgttnnnnnnnttgtcttatgatttgtcttataataaacatagttgtcatactcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13753485 |
attggaaatcattatggaatttgtatcgtgcctttggttttgagctgttaaaaaaattgtcttatgatttgtcttataataaacatagttgtcatactcg |
13753584 |
T |
 |
| Q |
201 |
tt |
202 |
Q |
| |
|
|| |
|
|
| T |
13753585 |
tt |
13753586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University