View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_276 (Length: 218)
Name: NF7708A_low_276
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_276 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 124 - 213
Target Start/End: Original strand, 32523477 - 32523566
Alignment:
| Q |
124 |
attgttttgtgtaatatgtgcaatatgatttataaacaaaccagaaagaatcatatgatataaccaattattgacatattatttttatgt |
213 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32523477 |
attggtttgtgtgatatgtgcaatatgatttataaacaaaccagaaagaatcatatgatataaccaattattgacatattatttttatgt |
32523566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 28 - 121
Target Start/End: Original strand, 32523249 - 32523341
Alignment:
| Q |
28 |
accgtcaacgccttttttctta-tataaaataatatcatcaaataattactannnnnnnnnnacaaaacaaaatgcaactttgttgtgttagtaa |
121 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32523249 |
accgtcaacgccttttttctttctataaaataatatcatcaaataattacta--ttttttttacaaaacaaaatgcaactttgttgtgttagtaa |
32523341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University