View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_277 (Length: 217)
Name: NF7708A_low_277
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_277 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 29 - 197
Target Start/End: Original strand, 47094265 - 47094433
Alignment:
| Q |
29 |
agagagagggtttggttttgttgttgagtttggttgagttggagaatgtagtagttgtgagtagtaagaagatgatgaacgtgtttgagtggtttgtttt |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47094265 |
agagagagggtttggttttgttgttgagtttggttgagttggagaatgtagtagttgtgagtagtaagaagatgatgaaagtgtttgagtggtttgtttt |
47094364 |
T |
 |
| Q |
129 |
gggtgccattgttgaatagaggggagatgagtgatgagaatgtttgttgttcatttgaaatagttgtta |
197 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47094365 |
gggtgccattgttgaatagaggtgagatgagtgatgagaatgttttttgttcatttgaaatagttgtta |
47094433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University