View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_285 (Length: 214)
Name: NF7708A_low_285
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_285 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 24 - 192
Target Start/End: Complemental strand, 41906180 - 41906016
Alignment:
| Q |
24 |
tatctccatctgaaatatagagtcagttaccaaataatt-aatcatggcggaatttatagtgcctcgcttgtactgctgctgtaattgtagaaaccatgt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41906180 |
tatctccatctgaaatatagagtcagttaccaaataatttaatcatggcggaatttatagtgcctcgcttgtactgctgctgtaattgtagaaaccatgt |
41906081 |
T |
 |
| Q |
123 |
ttcacttcatgatgatattatttccaaggcttttcaggtaacccaattaaattatttccatttttatttt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41906080 |
ttcacttcatgatgatattatttccaaggcttttcaggtaaccca-----attatttccatttttatttt |
41906016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University