View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_290 (Length: 211)
Name: NF7708A_low_290
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_290 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 23 - 211
Target Start/End: Original strand, 33104510 - 33104698
Alignment:
| Q |
23 |
ttgcataggcacaggtttgtttatggctcttcaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttacaggt |
122 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33104510 |
ttgcatatgcacaggtttgtttatggctctacaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttacaggt |
33104609 |
T |
|
| Q |
123 |
cctgcagtcatggctgcagcttccattgctgttggactgcgtggtaaccttttacgtgtagctattgttcaggtatataattaaccttg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33104610 |
cctgcagtcatggctgcagcttccattgctgttggactgcgtggtaaccttttacgtgtagctattgttcaggtatataattaaccttg |
33104698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 35 - 196
Target Start/End: Complemental strand, 10835967 - 10835806
Alignment:
| Q |
35 |
aggtttgtttatggctcttcaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttacaggtcctgcagtcatg |
134 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| || || |||||||||||||| |||||| | |||| ||||| ||||| ||||| ||| |
|
|
| T |
10835967 |
aggtctgtttatggctcttcaacccaagatcattgcatgtgggaattctgttgcttcatttgccatggctataagattccttactggtccagcagttatg |
10835868 |
T |
|
| Q |
135 |
gctgcagcttccattgctgttggactgcgtggtaaccttttacgtgtagctattgttcaggt |
196 |
Q |
| |
|
|| |||||||| || || ||||| || ||||| | ||| ||| |||||||||||||||||| |
|
|
| T |
10835867 |
gcagcagcttctatcgccgttggcctccgtgggaccctcctacatgtagctattgttcaggt |
10835806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University