View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_291 (Length: 211)
Name: NF7708A_low_291
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_291 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 6585693 - 6585520
Alignment:
| Q |
17 |
ataatatcccccgttgaactgaaatatgtgaaacatttgacacataagaactcatcagaagcaccggaacataaagttgaatttctgagagtagatactt |
116 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6585693 |
ataaaatcccccgttgaactgaaatctgtgaaacatttgacacataagaactcatcagatgcaccggaacataaagttgaatttctgagagtagatactt |
6585594 |
T |
 |
| Q |
117 |
gagtagaatctctcttctggtgattaccgtctgaacttccagcatcaagtccttcactgttttcatgaatacat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6585593 |
gagtagaatctctcttctggtgattaccgtctgaacttccagcatcaagtccttcaccgttttcatgaatacat |
6585520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 144 - 187
Target Start/End: Original strand, 51169285 - 51169328
Alignment:
| Q |
144 |
cgtctgaacttccagcatcaagtccttcactgttttcatgaata |
187 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
51169285 |
cgtctgaacttccagcatcaagtcctctactgtttgcatgaata |
51169328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University