View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7708A_low_293 (Length: 210)

Name: NF7708A_low_293
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7708A_low_293
NF7708A_low_293
[»] chr4 (1 HSPs)
chr4 (9-207)||(32523005-32523203)


Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 9 - 207
Target Start/End: Original strand, 32523005 - 32523203
Alignment:
9 tggagttgacgatggtgacgtgggaggacatttggacgtggatgccgtcggtgtttgggctgtttccggctgccatgatattgacaccttgcgtttttac 108  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
32523005 tggagttgacgatggtgacatgggaggacatttggacgtggatgccgtcggtgtttgggctgtttccggctgccatgatattgacaccttgcatttttac 32523104  T
109 attttcgcatccattgaacactatgtggaacatttgactattcattgatgtcaaaccactaatcataatgttttttgagttactaaattccaacgtctg 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32523105 attttcgcatccattgaacactatgtggaacatttgactattcattgatgtcaaaccactaatcataatgttttttgagttactaaattccaacgtctg 32523203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University