View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7708A_low_303 (Length: 205)

Name: NF7708A_low_303
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7708A_low_303
NF7708A_low_303
[»] chr7 (1 HSPs)
chr7 (18-186)||(6359103-6359271)
[»] chr3 (1 HSPs)
chr3 (113-186)||(32857285-32857358)


Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 6359271 - 6359103
Alignment:
18 aatatatttaataacgaaataataacagtagtagatagagagaattacaaggacgagcttaaattcaaaatgtctctcgtgtttgcatcaattgatttgc 117  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
6359271 aatatatttaataacgaaataataacagtagtaaatagagagaattacaaggacgagcttaaattcaaaacgtctctcgtgtttgcatcaattgatttgc 6359172  T
118 agtttctcagtccttttatatatggatatagcttcttgataatctgcatatactcaaggatctgacttc 186  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6359171 agtttctcaatccttttatatatggatatagcttcttgataatctgcatatactcaaggatctgacttc 6359103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 113 - 186
Target Start/End: Original strand, 32857285 - 32857358
Alignment:
113 tttgcagtttctcagtccttttatatatggatatagcttcttgataatctgcatatactcaaggatctgacttc 186  Q
    |||||||||||||| || ||||||  ||||| |||||||| ||| ||||| |||||| |||||||| |||||||    
32857285 tttgcagtttctcaatcattttatggatggaaatagcttcatgagaatctacatatagtcaaggatttgacttc 32857358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University