View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_306 (Length: 204)
Name: NF7708A_low_306
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_306 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 4e-80; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 36 - 186
Target Start/End: Original strand, 25988481 - 25988631
Alignment:
| Q |
36 |
atccttgtttgtcttagtttcctttgttgaggggttcgtagctccccattctcggttaccaactttccacttcacgacattatttgttaagaaggtctat |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988481 |
atccttgtttgtcttagtttcctttgttgaggggttcgtagctccccattctcggttaccaactttccacttcacgacattatttgttaagaaggtctat |
25988580 |
T |
|
| Q |
136 |
aatggacatccaatgtgcttccttacttatcgctatttgcggttagcgcca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988581 |
aatggacatccaatgtgcttccttacttatcgctatttgcggttagcgcca |
25988631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 51 - 133
Target Start/End: Original strand, 25320891 - 25320973
Alignment:
| Q |
51 |
agtttcctttgttgaggggttcgtagctccccattctcggttaccaactttccacttcacgacattatttgttaagaaggtct |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25320891 |
agtttcctttgttgaggggttcgtagctccccattctcggttaccaactttccacttcacgacattatttgttaagaaggtct |
25320973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 51 - 133
Target Start/End: Original strand, 26150584 - 26150666
Alignment:
| Q |
51 |
agtttcctttgttgaggggttcgtagctccccattctcggttaccaactttccacttcacgacattatttgttaagaaggtct |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26150584 |
agtttcctttgttgaggggttcgtagctccccattctcggttaccaactttccacttcacgacattatttgttaagaaggtct |
26150666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University