View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_39 (Length: 392)
Name: NF7708A_low_39
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 79 - 231
Target Start/End: Complemental strand, 4885013 - 4884861
Alignment:
| Q |
79 |
gctacgttggttgtgtcttctgatcagtacttgactgagattctgtctgagaaggtttgtagtcagagagatagaagaagaggacgtgttgctgtgtgga |
178 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4885013 |
gctacgttggttgtttcttctgatcagtacttgactgagattctgtctgagaaggtttgtagtcagagagacagaagaagaggacgtgttgctgtgtgga |
4884914 |
T |
 |
| Q |
179 |
gacctcatttggagagtatttctgagtcaccaacaaatcatctataacggttg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4884913 |
gacctcatttggagagtatttctgagtcaccaacaaatcatctataacggttg |
4884861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 352 - 388
Target Start/End: Complemental strand, 4884739 - 4884703
Alignment:
| Q |
352 |
gtaaagaagaaaataaactttgtttctgtcaattttg |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4884739 |
gtaaagaagaaaataaactttgtttctgtcaattttg |
4884703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University