View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_41 (Length: 386)
Name: NF7708A_low_41
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 10 - 380
Target Start/End: Complemental strand, 10119906 - 10119532
Alignment:
| Q |
10 |
agagagaaggagtgttgcttttggtacaagcaaaaggaac-gcaaagcgccatatttctattaaaccgttatat----ctttaaagcaatgtaaaatatc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10119906 |
agagagaaggagtgttgcttttggtacaagcaaaaggaaccgcaaagcgccatatttctattaaaccgttatatatatctttaaagcaatgtaaaatatc |
10119807 |
T |
 |
| Q |
105 |
aaacactcaaccatgttataaccgtccctacattttcatttcatgattcattcattattttcagtgatgttatcttgttcagtgtttcaaaaacccaaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119806 |
aaacactcaaccatgttataaccgtccctatattttcattgcatgattcattcattattttcagtgatgttatcttgttcagtgtttcaaaaacccaaca |
10119707 |
T |
 |
| Q |
205 |
ggacggttcaatcggttgtaccttaaactgacggtttggttattttagcggttcaataccagcttcgttcgggttcaagcaatttaaggcagttgaacca |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119706 |
ggacggttcaatcggttgtaccttaaactgacggtttggtta-tttagcggttcaatcccagtttcgttcgggttcaagcaatttaaggcagttgaacca |
10119608 |
T |
 |
| Q |
305 |
tgaaccatgaaccatgattcagaagttttgcttgtttgatgtcttatccgatttttaaaacattgatgtaattaat |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119607 |
tgaaccatgaaccatgattcagaagttttgcttgtttgatgtcttatccgatttttaaaacattgatgtaattaat |
10119532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University