View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_55 (Length: 358)
Name: NF7708A_low_55
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 129 - 352
Target Start/End: Original strand, 44546958 - 44547176
Alignment:
| Q |
129 |
ataattaatgtggaaagcttggtaatatgcaatcttatatttgtcaannnnnnnnnnnnctaatagtccacattttatctttcttttatgatgtgtatgt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546958 |
ataattaatgtggaaagcttggtaatatgcaatcttaaatttgtcaatttttcttttttctaatagtccacattttatctttcttttatgatgtgtatgt |
44547057 |
T |
|
| Q |
229 |
actatctattcgaatgccattgcttccagtcagcccatcggtaaccgttggatcgagaccaaatggttcagatcttgatcccatctaacagttagcgatg |
328 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547058 |
actat----tcgaatgtcattgcttccagtcagcccatcggtaaccgttggatcgagaccaaatggttcagatcttgatcccatctaacagttagcgatg |
44547153 |
T |
|
| Q |
329 |
caccgattgtgtgaatgtcggggg |
352 |
Q |
| |
|
||| ||||||||| |||||||||| |
|
|
| T |
44547154 |
cactgattgtgtg-atgtcggggg |
44547176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 9 - 64
Target Start/End: Original strand, 44546838 - 44546893
Alignment:
| Q |
9 |
gaaaagaacgatgtgaatgaggaagaaggtgtttcagctgtgaaagctacatttgt |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546838 |
gaaaagaacgatgtgaatgaggaagaaggtgtttcagctgtgaaagctacatttgt |
44546893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University