View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_71 (Length: 344)
Name: NF7708A_low_71
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_71 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 21 - 344
Target Start/End: Original strand, 4569493 - 4569816
Alignment:
| Q |
21 |
aaaactctcttaccaacgccgaatccactcgtggcacatcccttggacccaacaacttctctctatcccacactggctccaccatgatatgttccccgcc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569493 |
aaaactctcttaccaacgccgaatccactcgtggcacatcccttggacccaacaacttctctctatcccacactggctccaccatgatatgttccccgcc |
4569592 |
T |
|
| Q |
121 |
acgagccaactccgccatcgtgttgnnnnnnngcgtcccacccattccatcacaaagtgaatggtgaattgctgcaccgagagtgaacccaccgcacttg |
220 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569593 |
acgagccaactccgccatcgtgttgaaaaaaagcgtcccacccattccatcacaaagtgaatggtgaattgctgcaccgagagtgaacccaccgcacttg |
4569692 |
T |
|
| Q |
221 |
taaacagtgagttgaagcatgcatggatggtttaatccttcttccggttttgggtcgggtactaactgttcaacaaaatgggaagatgggtcgtcgtcga |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4569693 |
taaacagtgagttgaagcatgcatggatggtttaatccttcttccggttttgggtcgggtactaactgttcaacaaaatgggaagatgggtcgtcgtcga |
4569792 |
T |
|
| Q |
321 |
ggtagtttacggattcgagagtga |
344 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4569793 |
ggtagtttacggattcgagagtga |
4569816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University