View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708A_low_87 (Length: 321)
Name: NF7708A_low_87
Description: NF7708A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708A_low_87 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 23 - 207
Target Start/End: Complemental strand, 48344945 - 48344761
Alignment:
| Q |
23 |
cttaggccttgaaggagcgaaacacgaaccacctcgtgatttggctttgtacattgattctgtttcggaggaggacgataataaaccacttgaatctgaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48344945 |
cttaggccttgaaggagcgaaacacgaaccacctcgtgatttggctttgtacattgattctgtttcggaggaggatgataataaaccacttgaatctgaa |
48344846 |
T |
|
| Q |
123 |
gaacttgaagttgagctgaaaaacataacatcttggtcatgaatctcatgatcaagatgcaactttctgtctatttgtgtagtga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48344845 |
gaacttgaagttgagctgaaaaacataacatcttggtcatgaatctcatgatcaagatgcaactttctgtctatttgtgttgtga |
48344761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 265 - 311
Target Start/End: Complemental strand, 48344685 - 48344639
Alignment:
| Q |
265 |
ttttgctctgtttttgaaatgttgtttctgtatagaagttcatatca |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48344685 |
ttttgctctgtttttgaaatgttgtttctgtatagaacttcatatca |
48344639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University