View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708_high_23 (Length: 260)
Name: NF7708_high_23
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 5 - 104
Target Start/End: Complemental strand, 31860587 - 31860488
Alignment:
| Q |
5 |
aacacataacagtctttgaaaagtcgaacgatagttaactgctgttgagtcaacgacagtcgacaaaaagtagtttgagaagtaagaaaagtaatatcca |
104 |
Q |
| |
|
||||| ||| |||||||||||| ||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860587 |
aacacttaatagtctttgaaaaatcgaacgatggttaaccgccgttgagtcaacgacagtcgacaaaaagtagtttgagaagtaagaaaagtaatatcca |
31860488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 142 - 231
Target Start/End: Original strand, 51635159 - 51635244
Alignment:
| Q |
142 |
gtgaaccggttcttgaaagtaccgcgaaccggtacgtacaaaccggggattggcagtttgctacagtgttacacgaattatgttactatg |
231 |
Q |
| |
|
||||||||||||| |||||||||||||||||| | ||| |||||| || || ||| ||||||||| |||||||||||||| |||||| |
|
|
| T |
51635159 |
gtgaaccggttctcaaaagtaccgcgaaccggttcatacgaaccgg---tttgcggttcgctacagtg-tacacgaattatgtgactatg |
51635244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University