View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708_low_18 (Length: 372)
Name: NF7708_low_18
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 16 - 362
Target Start/End: Complemental strand, 32382213 - 32381867
Alignment:
| Q |
16 |
tggagttcagcaaaggaaaaactgttggcaagatggtgtgccaggaacaaactgtcccatcgcaccaggaacaaactacacataccgtttccaagtgaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32382213 |
tggagttcagcaaaggaaaaactgttggcaagatggtgtgccaggaacaaactgtcccatcgcacctggaacaaactacacataccgtttccaagtgaag |
32382114 |
T |
|
| Q |
116 |
gatcaaatcggtagctacttctattaccctagcttagggatgcacagagcagccggtggtttcggtggcctccgcatcaacagcagattactcattccag |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32382113 |
gatcaaatcggtagctacttctattatcctagcttagggatgcacagagcagccggtggtttcggtggcctccgcatcaacagcagattactcattccag |
32382014 |
T |
|
| Q |
216 |
tcccatatgctgatcccgaagatgattacaccgtcctaatcggtgattggttcaccaagagccactccaccctcagcaaattactcgacagtggtcgtgc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32382013 |
tcccatatgctgatcccgaagatgattacaccgtcctaatcggtgactggttcaccaagagccactccaccctcagcaaattactcgacagtggtcgtgc |
32381914 |
T |
|
| Q |
316 |
ccttggaagaccacaagctgttcttgttaacggccaaaacgccaaag |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32381913 |
ccttggaagaccacaagctgttcttgttaacggccaaaacgccaaag |
32381867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University