View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708_low_30 (Length: 295)
Name: NF7708_low_30
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708_low_30 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 19 - 295
Target Start/End: Original strand, 42475321 - 42475597
Alignment:
| Q |
19 |
attacaactggattttacttgcaaaatctgtttgtaagtgaatcattttgatagaatgcccctgggagctttgataaaaacccaaatacctccattcctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42475321 |
attacaactggattttacttgcaaaacctgtttgtaagtgaatcattttgatagaatgcccctgggagctttgataaaaacccaaatacctccattcctg |
42475420 |
T |
 |
| Q |
119 |
atagctcaaaaagctagttgggacatgttgcctatttttataatgcattaaaagctcagtgctgaaccgatatatgattgctaaatgattatttagctgt |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42475421 |
atagctcgaaaagctagttgggacatgttgcctatttttataatgcattaaaagctcagtgctgaaccgatatatgattgctaaatgattatttagctgt |
42475520 |
T |
 |
| Q |
219 |
ttgttaaacatgttgcctgtttgatcatttgtttgataaatatgttgatgatcatttattcatttatatcttatttt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42475521 |
ttgttaaacatgttgcctgtttgatcatttgtttgataaatatgttgatgatcatttattcatttatatcttatttt |
42475597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 189 - 245
Target Start/End: Original strand, 42480885 - 42480941
Alignment:
| Q |
189 |
tatatgattgctaaatgattatttagctgtttgttaaacatgttgcctgtttgatca |
245 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42480885 |
tatatgattgctaaatcgttatttagctgtttgttaaacatgttgcctgtttgatca |
42480941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University