View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708_low_34 (Length: 284)
Name: NF7708_low_34
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708_low_34 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 277
Target Start/End: Complemental strand, 18802760 - 18802484
Alignment:
| Q |
1 |
tcaagaaacatttcacttcggtagaacaccctcagatgaatggacaggtggagtctgccaatagggtcatattaaaaggtttgaagagaagattagagga |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||| || |||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18802760 |
tcaagcaacatttcacttcggtagaacacccttagatgaacgggtaggtggagtccgccaatagggtcatattaaaaggtttgaagataagattagagga |
18802661 |
T |
|
| Q |
101 |
ggcaaagggaagctggcccgaggtacttgcacacgtcttgtgggcataccgctccacaccgcattcaactaatgaggaaacaaatttttgcctcaccttc |
200 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18802660 |
ggcaaagggaagctgacccgaggtacttccacacgtcttgtgggcataccgcaccacaccgcattcaactaatgaggaaacacatttttgcctcaccttc |
18802561 |
T |
|
| Q |
201 |
aggacgaaggcgatgatcccagtcaaagtaaaagaattgagttagaggacgggacacccgctcaaccataacaccaa |
277 |
Q |
| |
|
| ||| |||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18802560 |
aagacagaggcgatgatcccaatcgaagtaaaagaattgagttagaggacggaacacccgctcaaccataacaccaa |
18802484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 415370 - 415540
Alignment:
| Q |
1 |
tcaagaaacatttcacttcggtagaacaccctcagatgaatggacaggtggagtctgccaatagggtcatattaaaaggtttgaagagaagattagagga |
100 |
Q |
| |
|
||||| |||| |||||||||||||||||| |||||| ||| ||||| ||||||| ||||| ||| | || | | ||| ||||||||||| |||||||| |
|
|
| T |
415370 |
tcaagcaacacttcacttcggtagaacactctcagacgaacagacagctggagtccgccaagaggatggtactgagaggattgaagagaaggttagagga |
415469 |
T |
|
| Q |
101 |
ggcaaagggaagctggcccgaggtacttgcacacgtcttgtgggcataccgctccacaccgcattcaacta |
171 |
Q |
| |
|
||||| ||||||||||||||| | || |||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
415470 |
ggcaatgggaagctggcccgaagaacgcccacacgtcttgtgggcgtaccgcaccacaccgcattcaacta |
415540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University