View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7708_low_36 (Length: 269)

Name: NF7708_low_36
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7708_low_36
NF7708_low_36
[»] chr3 (37 HSPs)
chr3 (138-251)||(1261514-1261627)
chr3 (2-93)||(1801435-1801526)
chr3 (11-93)||(45103098-45103180)
chr3 (2-92)||(41753022-41753112)
chr3 (1-85)||(30734399-30734483)
chr3 (1-92)||(51046063-51046154)
chr3 (1-68)||(47492061-47492128)
chr3 (1-86)||(30580752-30580837)
chr3 (20-93)||(30734478-30734551)
chr3 (2-58)||(47677279-47677335)
chr3 (2-86)||(50524760-50524844)
chr3 (1-56)||(30476500-30476555)
chr3 (1-92)||(33689233-33689315)
chr3 (20-85)||(41752961-41753026)
chr3 (20-83)||(43139785-43139848)
chr3 (20-83)||(47492123-47492186)
chr3 (20-85)||(51046149-51046214)
chr3 (1-93)||(43139707-43139790)
chr3 (2-44)||(29031752-29031794)
chr3 (20-86)||(33689172-33689238)
chr3 (1-56)||(50550032-50550087)
chr3 (1-91)||(49418691-49418772)
chr3 (28-89)||(18321644-18321705)
chr3 (52-92)||(1272557-1272597)
chr3 (55-94)||(49414525-49414564)
chr3 (5-44)||(55223293-55223332)
chr3 (20-78)||(30580832-30580890)
chr3 (20-85)||(50549972-50550037)
chr3 (2-54)||(18321709-18321761)
chr3 (11-59)||(21024117-21024165)
chr3 (20-92)||(50524692-50524764)
chr3 (9-59)||(45755128-45755178)
chr3 (35-89)||(55223225-55223279)
chr3 (28-89)||(29081592-29081653)
chr3 (28-92)||(7977584-7977648)
chr3 (50-86)||(35538960-35538996)
chr3 (20-56)||(47677331-47677367)
[»] chr8 (31 HSPs)
chr8 (1-92)||(5033218-5033309)
chr8 (1-92)||(33841581-33841672)
chr8 (1-92)||(35440959-35441050)
chr8 (2-78)||(10086815-10086891)
chr8 (2-89)||(39851013-39851100)
chr8 (2-92)||(45191117-45191207)
chr8 (20-85)||(5033158-5033223)
chr8 (1-85)||(5667154-5667238)
chr8 (1-89)||(8796479-8796567)
chr8 (21-92)||(5667087-5667158)
chr8 (2-91)||(4958657-4958745)
chr8 (20-85)||(33841667-33841732)
chr8 (20-85)||(35441045-35441110)
chr8 (20-89)||(43844545-43844614)
chr8 (1-92)||(8243387-8243469)
chr8 (20-85)||(2581822-2581887)
chr8 (20-85)||(8243464-8243529)
chr8 (20-85)||(22649842-22649907)
chr8 (1-56)||(34229698-34229753)
chr8 (1-56)||(34541829-34541884)
chr8 (1-83)||(6296662-6296744)
chr8 (5-59)||(31159912-31159966)
chr8 (7-57)||(35031639-35031689)
chr8 (31-92)||(1880229-1880289)
chr8 (20-85)||(45191203-45191268)
chr8 (20-86)||(8796418-8796484)
chr8 (20-85)||(10086754-10086819)
chr8 (20-89)||(34229634-34229703)
chr8 (7-59)||(37618750-37618802)
chr8 (20-56)||(6296631-6296667)
chr8 (1-92)||(43844461-43844550)
[»] chr5 (49 HSPs)
chr5 (1-92)||(16971201-16971292)
chr5 (1-94)||(2953247-2953340)
chr5 (1-91)||(3899896-3899986)
chr5 (1-94)||(2093925-2094018)
chr5 (1-90)||(29699424-29699513)
chr5 (2-86)||(19655216-19655300)
chr5 (1-94)||(291154-291247)
chr5 (1-92)||(30117818-30117909)
chr5 (1-79)||(12913860-12913938)
chr5 (1-83)||(28818974-28819056)
chr5 (11-92)||(2356339-2356419)
chr5 (20-95)||(12913790-12913865)
chr5 (1-56)||(16439195-16439250)
chr5 (25-94)||(13312252-13312321)
chr5 (20-89)||(16439131-16439200)
chr5 (20-85)||(19598329-19598394)
chr5 (20-85)||(19655155-19655220)
chr5 (21-85)||(291094-291158)
chr5 (1-86)||(26662456-26662542)
chr5 (1-86)||(26934051-26934137)
chr5 (1-94)||(3180057-3180141)
chr5 (2-55)||(16802502-16802555)
chr5 (11-94)||(14167141-14167223)
chr5 (20-89)||(3180136-3180204)
chr5 (25-86)||(32485630-32485691)
chr5 (1-56)||(19598389-19598443)
chr5 (2-83)||(228408-228489)
chr5 (20-89)||(1638450-1638519)
chr5 (1-50)||(38134405-38134454)
chr5 (54-94)||(28818914-28818954)
chr5 (20-68)||(29699381-29699429)
chr5 (11-90)||(19272258-19272337)
chr5 (29-92)||(29385390-29385453)
chr5 (11-58)||(37325582-37325629)
chr5 (9-91)||(11983247-11983328)
chr5 (35-92)||(22082989-22083045)
chr5 (46-83)||(39777050-39777087)
chr5 (20-83)||(30117904-30117967)
chr5 (58-92)||(43225441-43225475)
chr5 (28-92)||(7137631-7137695)
chr5 (29-94)||(19417433-19417498)
chr5 (20-56)||(3899865-3899901)
chr5 (17-61)||(7009401-7009445)
chr5 (20-56)||(16971170-16971206)
chr5 (56-92)||(26662398-26662434)
chr5 (20-56)||(26662425-26662461)
chr5 (56-92)||(26933993-26934029)
chr5 (20-56)||(26934020-26934056)
chr5 (35-83)||(39031242-39031290)
[»] chr1 (59 HSPs)
chr1 (1-92)||(48993907-48993998)
chr1 (1-92)||(29179587-29179678)
chr1 (1-92)||(5995426-5995517)
chr1 (1-92)||(15220868-15220959)
chr1 (2-95)||(29371426-29371519)
chr1 (1-85)||(17127561-17127645)
chr1 (1-92)||(49444903-49444992)
chr1 (1-75)||(32540755-32540829)
chr1 (1-87)||(33219630-33219716)
chr1 (20-93)||(28395626-28395699)
chr1 (20-85)||(48993993-48994058)
chr1 (20-91)||(32540824-32540895)
chr1 (20-86)||(9157306-9157372)
chr1 (20-86)||(21630038-21630104)
chr1 (20-85)||(29179673-29179738)
chr1 (20-85)||(37155043-37155108)
chr1 (1-56)||(741528-741583)
chr1 (1-56)||(1819515-1819570)
chr1 (20-86)||(1091620-1091686)
chr1 (27-85)||(36290490-36290548)
chr1 (2-91)||(28928779-28928859)
chr1 (20-85)||(46931994-46932059)
chr1 (2-93)||(48498473-48498554)
chr1 (5-56)||(34062270-34062321)
chr1 (1-56)||(37155103-37155158)
chr1 (20-83)||(44706860-44706923)
chr1 (1-92)||(46333945-46334027)
chr1 (2-56)||(4609054-4609108)
chr1 (20-86)||(17127640-17127706)
chr1 (26-92)||(46932064-46932129)
chr1 (2-58)||(8337875-8337931)
chr1 (2-44)||(1091582-1091624)
chr1 (2-56)||(47303453-47303507)
chr1 (20-89)||(4608989-4609058)
chr1 (20-85)||(5995366-5995431)
chr1 (1-54)||(9157367-9157420)
chr1 (1-56)||(44706809-44706865)
chr1 (1-53)||(45728344-45728396)
chr1 (20-75)||(45728294-45728349)
chr1 (11-56)||(19711206-19711251)
chr1 (11-56)||(38674531-38674576)
chr1 (30-86)||(31342259-31342315)
chr1 (7-86)||(12441018-12441097)
chr1 (1-56)||(48604973-48605028)
chr1 (20-54)||(46334022-46334056)
chr1 (22-92)||(48823884-48823945)
chr1 (20-85)||(48498412-48498477)
chr1 (2-58)||(5694914-5694969)
chr1 (29-93)||(9884830-9884894)
chr1 (2-33)||(36290456-36290487)
chr1 (13-83)||(25062024-25062093)
chr1 (30-92)||(36381582-36381644)
chr1 (11-55)||(2573182-2573226)
chr1 (20-56)||(8337927-8337963)
chr1 (29-93)||(9379807-9379871)
chr1 (58-94)||(26514245-26514281)
chr1 (20-56)||(29371394-29371430)
chr1 (56-92)||(44183438-44183474)
chr1 (20-56)||(49444987-49445023)
[»] chr4 (47 HSPs)
chr4 (1-93)||(47661899-47661991)
chr4 (1-92)||(42375067-42375158)
chr4 (1-92)||(23444259-23444350)
chr4 (1-92)||(51265502-51265593)
chr4 (1-92)||(6271759-6271850)
chr4 (4-94)||(53954670-53954760)
chr4 (1-79)||(35682223-35682301)
chr4 (20-90)||(26186090-26186160)
chr4 (1-92)||(50384104-50384186)
chr4 (2-92)||(31430460-31430541)
chr4 (20-85)||(51265442-51265507)
chr4 (20-83)||(23444345-23444408)
chr4 (1-92)||(47404584-47404666)
chr4 (20-86)||(3862622-3862688)
chr4 (20-86)||(3871379-3871445)
chr4 (2-92)||(40789237-40789318)
chr4 (2-56)||(52028607-52028661)
chr4 (20-85)||(6271699-6271764)
chr4 (30-94)||(30709986-30710050)
chr4 (20-92)||(35682156-35682228)
chr4 (2-68)||(25818387-25818453)
chr4 (1-83)||(44379987-44380069)
chr4 (20-85)||(30861850-30861915)
chr4 (2-54)||(28693951-28694003)
chr4 (5-56)||(24006096-24006147)
chr4 (22-92)||(44379920-44379990)
chr4 (1-55)||(55090023-55090077)
chr4 (2-44)||(45591448-45591490)
chr4 (5-59)||(47762669-47762723)
chr4 (11-56)||(26186042-26186087)
chr4 (5-85)||(38714884-38714964)
chr4 (20-68)||(47661856-47661904)
chr4 (28-86)||(5048884-5048942)
chr4 (33-86)||(2325069-2325122)
chr4 (26-83)||(47762607-47762664)
chr4 (1-33)||(30861823-30861855)
chr4 (29-93)||(31846896-31846960)
chr4 (21-56)||(17285807-17285842)
chr4 (28-91)||(46321439-46321502)
chr4 (17-59)||(22592918-22592960)
chr4 (20-58)||(40789203-40789241)
chr4 (56-89)||(24006165-24006198)
chr4 (7-56)||(49469934-49469983)
chr4 (31-83)||(337047-337098)
chr4 (21-61)||(31532766-31532806)
chr4 (31-59)||(36118323-36118351)
chr4 (24-56)||(53954636-53954668)
[»] chr2 (33 HSPs)
chr2 (1-93)||(16514481-16514573)
chr2 (1-92)||(38933644-38933735)
chr2 (2-95)||(14470579-14470672)
chr2 (2-84)||(6217222-6217304)
chr2 (1-94)||(29508678-29508772)
chr2 (1-94)||(6722008-6722101)
chr2 (2-93)||(37961764-37961855)
chr2 (1-80)||(14229355-14229434)
chr2 (2-92)||(14892318-14892408)
chr2 (11-89)||(32545855-32545933)
chr2 (2-55)||(15011338-15011391)
chr2 (1-56)||(2828641-2828696)
chr2 (2-72)||(29925580-29925650)
chr2 (1-55)||(37762028-37762082)
chr2 (20-85)||(16514421-16514486)
chr2 (20-85)||(29508767-29508832)
chr2 (21-80)||(9173058-9173117)
chr2 (3-86)||(24115979-24116062)
chr2 (19-78)||(33018620-33018679)
chr2 (36-86)||(45213892-45213942)
chr2 (1-54)||(2894020-2894073)
chr2 (20-61)||(6721972-6722013)
chr2 (20-89)||(24115913-24115982)
chr2 (29-91)||(39819054-39819116)
chr2 (20-56)||(38933613-38933649)
chr2 (55-94)||(2893960-2893999)
chr2 (2-44)||(8534204-8534246)
chr2 (28-86)||(32545782-32545840)
chr2 (55-92)||(14229454-14229491)
chr2 (48-85)||(37632988-37633025)
chr2 (20-56)||(2828610-2828646)
chr2 (15-55)||(14464582-14464622)
chr2 (20-68)||(15011294-15011342)
[»] chr7 (29 HSPs)
chr7 (1-92)||(11016926-11017017)
chr7 (4-92)||(4290605-4290693)
chr7 (5-93)||(42628356-42628444)
chr7 (2-92)||(48000795-48000885)
chr7 (7-85)||(48000691-48000769)
chr7 (2-61)||(15027600-15027659)
chr7 (1-92)||(38975862-38975953)
chr7 (23-85)||(41018307-41018369)
chr7 (20-85)||(11016866-11016931)
chr7 (23-85)||(45231929-45231991)
chr7 (20-91)||(27028719-27028790)
chr7 (2-89)||(27028795-27028873)
chr7 (20-85)||(34854771-34854836)
chr7 (20-85)||(38975802-38975867)
chr7 (2-58)||(29053338-29053394)
chr7 (2-58)||(34854719-34854775)
chr7 (5-56)||(41018254-41018305)
chr7 (2-56)||(7671937-7671991)
chr7 (13-86)||(41945924-41945997)
chr7 (24-85)||(4290542-4290603)
chr7 (9-58)||(4649387-4649436)
chr7 (1-58)||(10419515-10419572)
chr7 (20-85)||(15027539-15027604)
chr7 (20-80)||(27028869-27028929)
chr7 (20-61)||(22764776-22764817)
chr7 (11-56)||(41084206-41084251)
chr7 (23-56)||(42628321-42628354)
chr7 (7-79)||(6225529-6225600)
chr7 (56-92)||(45231853-45231889)
[»] scaffold0016 (2 HSPs)
scaffold0016 (1-92)||(49693-49784)
scaffold0016 (20-56)||(49779-49815)
[»] chr6 (17 HSPs)
chr6 (1-92)||(24618591-24618682)
chr6 (1-93)||(13043514-13043606)
chr6 (1-76)||(12343157-12343232)
chr6 (2-92)||(17750960-17751050)
chr6 (20-92)||(24587451-24587523)
chr6 (1-58)||(10521873-10521930)
chr6 (18-92)||(7384478-7384552)
chr6 (19-85)||(24975749-24975815)
chr6 (1-56)||(551191-551246)
chr6 (20-83)||(551241-551304)
chr6 (5-56)||(2315330-2315381)
chr6 (21-89)||(17750896-17750963)
chr6 (20-89)||(24618677-24618737)
chr6 (1-41)||(24587518-24587558)
chr6 (20-56)||(31654331-31654367)
chr6 (49-94)||(6299162-6299208)
chr6 (49-94)||(6305972-6306018)
[»] scaffold0586 (2 HSPs)
scaffold0586 (1-79)||(7050-7128)
scaffold0586 (20-86)||(7123-7188)
[»] scaffold0161 (2 HSPs)
scaffold0161 (5-85)||(27217-27297)
scaffold0161 (23-85)||(27299-27361)
[»] scaffold0180 (1 HSPs)
scaffold0180 (2-89)||(19115-19202)
[»] scaffold0047 (1 HSPs)
scaffold0047 (2-56)||(63815-63869)
[»] scaffold1033 (1 HSPs)
scaffold1033 (1-53)||(2270-2322)
[»] scaffold1029 (1 HSPs)
scaffold1029 (1-53)||(2270-2322)
[»] scaffold0481 (1 HSPs)
scaffold0481 (2-56)||(2913-2967)
[»] scaffold0536 (1 HSPs)
scaffold0536 (5-61)||(4913-4969)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 37)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 138 - 251
Target Start/End: Original strand, 1261514 - 1261627
Alignment:
138 gaatttactccgtactttttatcatcactagagaatactccaaatagtactaggttagatgtttgtgctatttaatgttgagtaataaatgtaaattgtt 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
1261514 gaatttactccgtactttttatcatcactagagaatactccaaatagtactaggttagacgtttgtgctatttaatgttgagtaataaatgtaaattgtt 1261613  T
238 acgatactacaaat 251  Q
    ||||||||||||||    
1261614 acgatactacaaat 1261627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 2 - 93
Target Start/End: Complemental strand, 1801526 - 1801435
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||| ||||||    
1801526 ttgtgtttctctctctttcacaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaagtgttacccc 1801435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 11 - 93
Target Start/End: Complemental strand, 45103180 - 45103098
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    |||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||||||||    
45103180 tctctctttcacaagcattgtgacattgtgattgatcaatatcaccaatgtcacccaactctatgtcacccaagtgctacccc 45103098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 2 - 92
Target Start/End: Original strand, 41753022 - 41753112
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||| |||||||||||||||||||| |||||||||||| ||||||||||||||| || ||||||||||||||||||||| |||||    
41753022 ttgtgtttctttctctttcacaagcattgtggcattgtgattggccaatgtcaccaatgtcactcaactctatgtcacccaagtgttaccc 41753112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 30734483 - 30734399
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||| ||| ||||||||||||| |||||    
30734483 cttgtgtttctctatctttcacaagcattgtgacattgtgatcggtcaatgtcatcaatgtcaccaaactctatgtcacacaagt 30734399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 51046154 - 51046063
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||| | | |||||||||||||| |||| ||||||||    
51046154 cttgtgtttctctctctttcacaaacattgtgacattatgattgatcaatgtcaccaatatcatccaactctatgtcatccaaatgctaccc 51046063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 47492128 - 47492061
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaa 68  Q
    ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||||||    
47492128 cttgtgtttctctctttttcacaagcattgtgacattgtgattggccaatgtcaccaatgtcacccaa 47492061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 30580837 - 30580752
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||||| ||||||||||||  ||||||||||| |||||||||||| |||||||||| |||||| |||||||||| ||||||    
30580837 cttgtgtttctatctctttcacaaatattgtgacattatgattggtcaatatcaccaatgtcacccaattctatgtcactcaagtg 30580752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 93
Target Start/End: Original strand, 30734478 - 30734551
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    |||||| ||| ||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||    
30734478 cacaagtattatgacattgtgattggccaatgtcaccaatgtcacctaactctatgtcacccaagtgctacccc 30734551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 47677335 - 47677279
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaa 58  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
47677335 ttgtgtttctctctctttcacaagcattgtgacattgtgatcggtcaatgtcaccaa 47677279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 2 - 86
Target Start/End: Original strand, 50524760 - 50524844
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||||||||||||||||||||| || ||||||||||||   ||| |||||||||| || |||||||||||||||||||||    
50524760 ttgtgtttctctctctttcacaagcatcgtaacattgtgattgactaatatcaccaatgtcactcaactctatgtcacccaagtg 50524844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 30476555 - 30476500
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
30476555 cttgtgtttctctctctttcacaagcattgtgacattgtgattggccaatgtcacc 30476500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 33689233 - 33689315
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||         |||||| ||||||||||||||||||||    
33689233 cttgtgtttctctctctttcacaagcattgtgacattgtgattggccaatgtcacc---------caactcaatgtcacccaagtgctaccc 33689315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 41753026 - 41752961
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||| ||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||    
41753026 cacaaacattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaagt 41752961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 43139785 - 43139848
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    ||||||||||||| |||||| ||||| ||||||||||||||| |||||||||||||||||||||    
43139785 cacaagcattgtggcattgttattggccaatgtcaccaatgtcacccaactctatgtcacccaa 43139848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 47492123 - 47492186
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    |||||||||||||||||||||||||| |||| | |||||||| |||||||||||||||||||||    
47492123 cacaagcattgtgacattgtgattggccaatatgaccaatgtcacccaactctatgtcacccaa 47492186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 51046149 - 51046214
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    |||||||||| || |||||||||||| ||||||||||||||| | |||||||||||||||||||||    
51046149 cacaagcattatggcattgtgattggccaatgtcaccaatgtcatccaactctatgtcacccaagt 51046214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 43139790 - 43139707
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    ||||||||||||||||||||||||||||| ||||||||||||||         ||| |||| ||||||||||||||||| |||||||||||||    
43139790 cttgtgtttctctctctttcacaagcattctgacattgtgattg---------accgatgtcacccaactctatgtcactcaagtgctacccc 43139707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 29031794 - 29031752
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattg 44  Q
    |||||||||||||||||||||||||||||||||||||||||||    
29031794 ttgtgtttctctctctttcacaagcattgtgacattgtgattg 29031752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 33689238 - 33689172
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    |||||||||||||||||||||||||  |||| ||| |||||| ||||||||||||||||| ||||||    
33689238 cacaagcattgtgacattgtgattgaccaatatcatcaatgtcacccaactctatgtcacacaagtg 33689172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 50550032 - 50550087
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||||| |||| ||||||| |||||| |||||||||||    
50550032 cttgtgtttctctctctttcacaaacattatgacattatgattgatcaatgtcacc 50550087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 49418772 - 49418691
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacc 91  Q
    ||||||||||||||||||||||||  ||| ||||||||||||||         |||||| | |||||||||||||||||||||||||||||    
49418772 cttgtgtttctctctctttcacaaatattatgacattgtgattg---------accaatatcacccaactctatgtcacccaagtgctacc 49418691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 28 - 89
Target Start/End: Complemental strand, 18321705 - 18321644
Alignment:
28 ttgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    |||||||||||||||||  ||||||||||||| | ||||||||||||||  |||||||||||    
18321705 ttgtgacattgtgattgaccaatgtcaccaatatcacccaactctatgttgcccaagtgcta 18321644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 52 - 92
Target Start/End: Original strand, 1272557 - 1272597
Alignment:
52 tcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||| ||||||||||||||||||||||||||||||    
1272557 tcaccaatgtcacccaactctatgtcacccaagtgctaccc 1272597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 55 - 94
Target Start/End: Original strand, 49414525 - 49414564
Alignment:
55 ccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    ||||||| ||||||||||||||||||||||||||||||||    
49414525 ccaatgtcacccaactctatgtcacccaagtgctacccct 49414564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 44
Target Start/End: Original strand, 55223293 - 55223332
Alignment:
5 tgtttctctctctttcacaagcattgtgacattgtgattg 44  Q
    ||||||||||||||||||||||||||||||||| ||||||    
55223293 tgtttctctctctttcacaagcattgtgacattatgattg 55223332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 78
Target Start/End: Original strand, 30580832 - 30580890
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtca 78  Q
    |||||||| ||||||||||||||||  ||||||||| ||||| |||||| |||||||||    
30580832 cacaagcactgtgacattgtgattgaccaatgtcacaaatgtcacccaattctatgtca 30580890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 50550037 - 50549972
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    |||||||||||| | ||||||||||||||||||||||||| | ||||| || ||| |||| |||||    
50550037 cacaagcattgtaatattgtgattggtcaatgtcaccaatatcacccagctttatatcactcaagt 50549972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 54
Target Start/End: Original strand, 18321709 - 18321761
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtca 54  Q
    |||||||| ||||| ||||||| ||||||||||||||||||||  ||||||||    
18321709 ttgtgtttttctctttttcacatgcattgtgacattgtgattgaccaatgtca 18321761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 59
Target Start/End: Complemental strand, 21024165 - 21024117
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaat 59  Q
    ||||||||||||||| |||||||||||||| |||  |||||||||||||    
21024165 tctctctttcacaagaattgtgacattgtgtttgaccaatgtcaccaat 21024117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 92
Target Start/End: Complemental strand, 50524764 - 50524692
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||| |||||||||||| |||||||||||||||| || | | || ||||||||||||| || |||| |||||    
50524764 cacaaacattgtgacattatgattggtcaatgtcatcattatcactcaactctatgtcatcccagtgttaccc 50524692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 59
Target Start/End: Original strand, 45755128 - 45755178
Alignment:
9 tctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaat 59  Q
    ||||||||||||||||| |||||||| ||| |||||| |||||| ||||||    
45755128 tctctctctttcacaaggattgtgacgttgcgattggccaatgttaccaat 45755178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 89
Target Start/End: Complemental strand, 55223279 - 55223225
Alignment:
35 attgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    ||||||||||  |||| |||||||||| ||| ||||||||||||| |||||||||    
55223279 attgtgattgaccaatatcaccaatgtcacctaactctatgtcacacaagtgcta 55223225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 28 - 89
Target Start/End: Complemental strand, 29081653 - 29081592
Alignment:
28 ttgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    ||||||||||||| ||||||||||||||| |||| ||| | | | ||||||||||| |||||    
29081653 ttgtgacattgtggttggtcaatgtcaccgatgtcaccaaccacaatgtcacccaaatgcta 29081592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 28 - 92
Target Start/End: Original strand, 7977584 - 7977648
Alignment:
28 ttgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||| |||| |||| ||| |||||| | | || ||||||||||||||| |||||||    
7977584 ttgtgacattgtggttggccaatatcatcaatgtcatcaaattctatgtcacccaagcgctaccc 7977648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 50 - 86
Target Start/End: Original strand, 35538960 - 35538996
Alignment:
50 tgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    |||||||||||| |||||||||||||||| |||||||    
35538960 tgtcaccaatgtcacccaactctatgtcatccaagtg 35538996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 47677331 - 47677367
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||| ||||||||||||||||||| |||||||||||    
47677331 cacaaacattgtgacattgtgattgatcaatgtcacc 47677367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 31)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 5033218 - 5033309
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
5033218 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgtcacccaactctatgtcacccaagtgctaccc 5033309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 33841672 - 33841581
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
33841672 cttgtgtttctctctctttcacaagcattgtgacaatgtgattggtcaatgtcaccaatgtcacccaactctatgtcacccaagtgctaccc 33841581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 35441050 - 35440959
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||    
35441050 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgtcacccaactctaagtcacccaagtgctaccc 35440959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 2 - 78
Target Start/End: Original strand, 10086815 - 10086891
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtca 78  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||    
10086815 ttgtgtttctctctctttcacaaacattgtgacattgtgattggtcaatgtcaccaatgtcacccaactctatgtca 10086891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 2 - 89
Target Start/End: Original strand, 39851013 - 39851100
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    |||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||| || ||||| ||||||| ||||||||||    
39851013 ttgtgtttctctctctttcacaagcattataatattgtgattggtcaatgtcaccaatgtcactcaactttatgtcatccaagtgcta 39851100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 2 - 92
Target Start/End: Complemental strand, 45191207 - 45191117
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||| |||||||||| ||||||||||  |||||||||||||| | | |||||||||||||||||||||| |||||    
45191207 ttgtgtttctctctctttcataagcattgtggcattgtgattaatcaatgtcaccaatatcatccaactctatgtcacccaagtgttaccc 45191117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 5033223 - 5033158
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||    
5033223 cacaagcattgtggcattgtgattggtcaatgtcaccaatgtcacccaactctatgtcacccaagt 5033158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 5667154 - 5667238
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||| ||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||| | | |||||||||||||||||||    
5667154 cttgtatttctctctctttcacaagcattatgacattgtaattggccaatgtcaccaatgtcatcaaactctatgtcacccaagt 5667238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 8796479 - 8796567
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    ||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| | ||| | ||||||||||| || ||||||    
8796479 cttgtgtttctctatctttcacaagcattgtgacattttgattggtcaatgtcaccaatatcacctagctctatgtcacacatgtgcta 8796567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 21 - 92
Target Start/End: Complemental strand, 5667158 - 5667087
Alignment:
21 acaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||  ||||||||||||||| | ||||||||||||||||||||||||||||    
5667158 acaagcattgtgacattgtgattgaccaatgtcaccaatgtcatccaactctatgtcacccaagtgctaccc 5667087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 2 - 91
Target Start/End: Original strand, 4958657 - 4958745
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacc 91  Q
    |||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||| | | | ||||||||||||| |||||||||||    
4958657 ttgtgtttctctctctttcacaagtattgtgac-ttgtgattggtcaatgtcactaatatcatctaactctatgtcacgcaagtgctacc 4958745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 33841667 - 33841732
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||    
33841667 cacaagcattgtggcattctgattggtcaatgtcaccaatgtcacccaactctatgtcacccaagt 33841732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 35441045 - 35441110
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||    
35441045 cacaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaagt 35441110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 89
Target Start/End: Original strand, 43844545 - 43844614
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    ||||||||||||||||||||||||| ||||| |||||||||| | ||||||||||||||||||| |||||    
43844545 cacaagcattgtgacattgtgattgatcaatatcaccaatgtcatccaactctatgtcacccaattgcta 43844614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 8243469 - 8243387
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||||||||||||| ||||||||||| ||||||||         || |||||||||||||||||||||||||||    
8243469 cttgtgtttctctctctttcacaagcattgtggcattgtgattgatcaatgtc---------actcaactctatgtcacccaagtgctaccc 8243387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 2581887 - 2581822
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||| |||||||| |||||| |||||| ||||||||||||||||    
2581887 cacaagcattgtggcattgtgattggccaatgtcaacaatgtcacccaattctatgtcacccaagt 2581822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 8243464 - 8243529
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||  ||| ||||||||||| |||||||||||||||||||||||    
8243464 cacaagcattgtggcattgtgattgaccaacgtcaccaatgtcacccaactctatgtcacccaagt 8243529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 22649907 - 22649842
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||| | ||||||||||||||| || ||||||||||||||||||||    
22649907 cacaagcattgtggcattgtgattagccaatgtcaccaatgtcactcaactctatgtcacccaagt 22649842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 34229698 - 34229753
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||    
34229698 cttgtgtttctctctctttcacaagcattgtgatattgtgattgaccaatgtcacc 34229753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 34541884 - 34541829
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||    
34541884 cttgtgtttctctctctttcacaagcattgtgatattatgattggccaatgtcacc 34541829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 6296662 - 6296744
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    ||||||||||||||||||||||||| ||||||||||| | ||||   |||||||| ||||| | |||||||||| ||||||||    
6296662 cttgtgtttctctctctttcacaagtattgtgacattataattgactaatgtcactaatgtcatccaactctatatcacccaa 6296744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 5 - 59
Target Start/End: Original strand, 31159912 - 31159966
Alignment:
5 tgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaat 59  Q
    ||||||||||||||||||||||||||||||||| |||||||  ||||||||||||    
31159912 tgtttctctctctttcacaagcattgtgacattatgattggcgaatgtcaccaat 31159966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 7 - 57
Target Start/End: Complemental strand, 35031689 - 35031639
Alignment:
7 tttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacca 57  Q
    |||||||||||||||||||||||| ||||||||||||| ||||||||||||    
35031689 tttctctctctttcacaagcattgcgacattgtgattgatcaatgtcacca 35031639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 31 - 92
Target Start/End: Complemental strand, 1880289 - 1880229
Alignment:
31 tgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||| ||| | |||| |||||||||||||||||||||||    
1880289 tgacattgtgattggtcaatgtcaccagtgtca-ccaattctatgtcacccaagtgctaccc 1880229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 45191203 - 45191268
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||| |||||| ||||| ||||||||||||||||||||| | | |||||||||||||||||||||    
45191203 cacaaacattgtaacattttgattggtcaatgtcaccaatatcatccaactctatgtcacccaagt 45191268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 8796484 - 8796418
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    |||||||||||||||||||||||||  |||| |||| ||| | ||| ||||||||||||||||||||    
8796484 cacaagcattgtgacattgtgattgaccaatatcacaaatatcacctaactctatgtcacccaagtg 8796418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 10086819 - 10086754
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||| |||| ||||||||||||||  ||||||||| ||||| |||||| ||||||||||||||||    
10086819 cacaaacattatgacattgtgattgaccaatgtcactaatgtcacccaattctatgtcacccaagt 10086754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 89
Target Start/End: Complemental strand, 34229703 - 34229634
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    |||||||||| ||||||||||||||    ||||||| ||||| ||||||||||||||||| |||||||||    
34229703 cacaagcattctgacattgtgattgactcatgtcactaatgtcacccaactctatgtcacacaagtgcta 34229634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 37618802 - 37618750
Alignment:
7 tttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaat 59  Q
    ||||||||||| | ||||| ||||||||||||||||||| |||||||||||||    
37618802 tttctctctctcttacaaggattgtgacattgtgattggccaatgtcaccaat 37618750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 6296667 - 6296631
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||| ||||||||||||||||||||||||||    
6296667 cacaagcattatgacattgtgattggtcaatgtcacc 6296631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 43844550 - 43844461
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||  |||||||||  ||||||| |||||   |||| ||| |||| | |||||||||||||||| |||| || |||||    
43844550 cttgtgtttctctctct--cacaagcatcctgacattatgattaaccaatatcatcaatatcacccaactctatgtcatccaaatgttaccc 43844461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 49)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 16971201 - 16971292
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
16971201 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgtcacccaactctatgtcacccaagtgctaccc 16971292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 2953247 - 2953340
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||    
2953247 cttgtgtttctctctctttcacaagcattgtgacattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaagtgctacccct 2953340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 3899896 - 3899986
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacc 91  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||    
3899896 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgtcacccaactctaagtcacccaagtgctacc 3899986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 2094018 - 2093925
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||    
2094018 cttgtgtttctctctctttcacaagcattatgacattgtgattgatcaatgtcaccaatatcacccaactctatgtcacccaagtgctacccct 2093925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 29699424 - 29699513
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctac 90  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||||||||    
29699424 cttgtgtttctctctctttcacaagcattgtgacattgtgattggccaatgtcaccaatatcacccaactctatgtcacccaagtgctac 29699513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 2 - 86
Target Start/End: Original strand, 19655216 - 19655300
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||    
19655216 ttgtgtttctctctctttcacaagcattgtgacattgtgattggacaatgtcaccaatgtcactcaactctatgtcacccaagtg 19655300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 291154 - 291247
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    ||||| ||||| |||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||| |||||||||||||||||||    
291154 cttgtatttctttctctttcacaaacattgtgacattgtgattgatcaatgtcaccaatgtcacccaactctatatcacccaagtgctacccct 291247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 30117909 - 30117818
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||| ||||| || ||||||||||||||||||||||||| |||||||||| |||||||||||| |||||||| ||||||||    
30117909 cttgtgtttctctctttttcataaacattgtgacattgtgattggtcaatatcaccaatgtcacccaactctatatcacccaaatgctaccc 30117818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 12913860 - 12913938
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcac 79  Q
    ||||||| ||||||||||||||||||||| ||||||||||||||  |||| |||||||||| |||||||||||||||||    
12913860 cttgtgtatctctctctttcacaagcattatgacattgtgattgaccaatatcaccaatgtcacccaactctatgtcac 12913938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 28818974 - 28819056
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    ||||| ||||||||||||||||||||||||||||||| ||||||  ||||||||||||| | || ||||||||||||||||||    
28818974 cttgtatttctctctctttcacaagcattgtgacattatgattgaccaatgtcaccaatatcactcaactctatgtcacccaa 28819056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 11 - 92
Target Start/End: Original strand, 2356339 - 2356419
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||| |||||||||||||| |||||||| ||||||||||||||| | ||||||||||||||| ||||||||||||    
2356339 tctctctttcataagcattgtgacat-gtgattggccaatgtcaccaatgtcatccaactctatgtcacacaagtgctaccc 2356419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 95
Target Start/End: Complemental strand, 12913865 - 12913790
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccctc 95  Q
    |||||| ||||||||||||||||||| ||||||||||||||| || ||||| |||||||| |||||||||||||||    
12913865 cacaagaattgtgacattgtgattggccaatgtcaccaatgtcactcaactatatgtcacacaagtgctacccctc 12913790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 16439195 - 16439250
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
16439195 cttgtgtttctctctctttcacaagcattgtgacattgtgattgatcaatgtcacc 16439250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 25 - 94
Target Start/End: Complemental strand, 13312321 - 13312252
Alignment:
25 gcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    |||||||||||||||||||| ||||||||| |||||| ||| |||||||||||||| |||||||||||||    
13312321 gcattgtgacattgtgattgatcaatgtcatcaatgtcacctaactctatgtcacctaagtgctacccct 13312252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 89
Target Start/End: Complemental strand, 16439200 - 16439131
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    |||||||||||||||||||||||||  ||||||||||||| |||||||||||||| ||| ||||||||||    
16439200 cacaagcattgtgacattgtgattgaccaatgtcaccaatattacccaactctatatcatccaagtgcta 16439131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 19598394 - 19598329
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    |||||||||||||  ||||||||||  |||||||||||||||||||||||||||||||||||||||    
19598394 cacaagcattgtggtattgtgattgaccaatgtcaccaatgttacccaactctatgtcacccaagt 19598329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 19655220 - 19655155
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||| ||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||    
19655220 cacaaacattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaagt 19655155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 21 - 85
Target Start/End: Complemental strand, 291158 - 291094
Alignment:
21 acaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    |||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||| |||||    
291158 acaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcactcaagt 291094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 26662456 - 26662542
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtga-ttggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||||||||| ||||||||| ||||||||||||||| |||  ||||||||||||| | ||||||||||| ||||| ||||||    
26662456 cttgtgtttctctctttttcacaagtattgtgacattgtgatttgaccaatgtcaccaatatcacccaactctaagtcacacaagtg 26662542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 26934051 - 26934137
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtga-ttggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||||||||| ||||||||| ||||||||||||||| |||  ||||||||||||| | ||||||||||| ||||| ||||||    
26934051 cttgtgtttctctctttttcacaagtattgtgacattgtgatttgaccaatgtcaccaatatcacccaactctaagtcacacaagtg 26934137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 3180141 - 3180057
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    |||||||||||||||||||||||| |||||||||||| |||||| ||||||||         ||||||||||||||||| ||||||||||||||    
3180141 cttgtgtttctctctctttcacaaacattgtgacattatgattgatcaatgtc---------acccaactctatgtcacacaagtgctacccct 3180057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 2 - 55
Target Start/End: Original strand, 16802502 - 16802555
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcac 55  Q
    |||||||||||||||||| ||||||||||||||||| |||||||||||||||||    
16802502 ttgtgtttctctctcttttacaagcattgtgacattctgattggtcaatgtcac 16802555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 11 - 94
Target Start/End: Complemental strand, 14167223 - 14167141
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    ||||||||||||||| ||||||||||||||||| ||||| ||||||||| | |  ||| ||||| |||||||||||||||||||    
14167223 tctctctttcacaaggattgtgacattgtgattcgtcaaagtcaccaatatca-tcaattctatatcacccaagtgctacccct 14167141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 89
Target Start/End: Original strand, 3180136 - 3180204
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    ||||||||||||| |||||||||||  ||||||||||||||||| |||||||||||| || |||||||||    
3180136 cacaagcattgtggcattgtgattgaccaatgtcaccaatgtta-ccaactctatgtgacacaagtgcta 3180204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 25 - 86
Target Start/End: Original strand, 32485630 - 32485691
Alignment:
25 gcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||| |||||||||| |||||||||||||||| |||||||||| |||||| ||||||    
32485630 gcattgtgatattgtgattgatcaatgtcaccaatgtcacccaactctgtgtcacacaagtg 32485691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 19598389 - 19598443
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||||||||||| ||||||| |||||||| |||||||||    
19598389 cttgtgtttctctctctttcacaagcatt-tgacattatgattggttaatgtcacc 19598443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 2 - 83
Target Start/End: Original strand, 228408 - 228489
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    |||||||| ||||||||| ||||||||| ||||||||||||||   ||| ||| |||| |||||||||| ||||||| ||||    
228408 ttgtgtttttctctcttttacaagcattttgacattgtgattgacaaatctcatcaatattacccaactttatgtcatccaa 228489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 89
Target Start/End: Complemental strand, 1638519 - 1638450
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    ||||| |||||||||||||||||||| |||| |||| ||| | |||||||||||| ||||| ||||||||    
1638519 cacaaacattgtgacattgtgattggccaatatcacaaatatcacccaactctatatcacctaagtgcta 1638450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 38134454 - 38134405
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaat 50  Q
    ||||||||||| |||||||||| |||||||||||||||||||||| ||||    
38134454 cttgtgtttctttctctttcactagcattgtgacattgtgattggccaat 38134405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 54 - 94
Target Start/End: Complemental strand, 28818954 - 28818914
Alignment:
54 accaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    |||||||| ||||||||||||||||||||||||||||||||    
28818954 accaatgtcacccaactctatgtcacccaagtgctacccct 28818914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 29699429 - 29699381
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaa 68  Q
    ||||||||||||| |||||||||||| ||||||||||||||| ||||||    
29699429 cacaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaa 29699381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 90
Target Start/End: Complemental strand, 19272337 - 19272258
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctac 90  Q
    ||||||||||||||  ||| ||  |||||||||||||||| |||||||| | || ||||||||||||| |||| ||||||    
19272337 tctctctttcacaaatattatgtaattgtgattggtcaatttcaccaatatcactcaactctatgtcatccaaatgctac 19272258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 92
Target Start/End: Original strand, 29385390 - 29385453
Alignment:
29 tgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||| |||| ||||||||||||||| ||| | | | ||||||||||||||||||||    
29385390 tgtgacattgtggttggccaatgtcaccaatgtcaccaaccacaatgtcacccaagtgctaccc 29385453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 37325629 - 37325582
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaa 58  Q
    ||||||||||||||| ||||||||||||||||| ||||||| ||||||    
37325629 tctctctttcacaaggattgtgacattgtgattcgtcaatgccaccaa 37325582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 9 - 91
Target Start/End: Complemental strand, 11983328 - 11983247
Alignment:
9 tctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacc 91  Q
    ||||||||| || |||  ||||||||||| ||||||  ||||||||||||| | ||| || ||||||||||||||||||||||    
11983328 tctctctctctctcaaagattgtgacattttgattgaccaatgtcaccaatatcacc-aattctatgtcacccaagtgctacc 11983247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 35 - 92
Target Start/End: Complemental strand, 22083045 - 22082989
Alignment:
35 attgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||  ||||| || |||||||||||||||||| ||||||||    
22083045 attgtgattggtcaatgtcattaatgtcacacaactctatgtcacccaa-tgctaccc 22082989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 83
Target Start/End: Complemental strand, 39777087 - 39777050
Alignment:
46 tcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    |||||||||||||||| |||||||||||||||||||||    
39777087 tcaatgtcaccaatgtcacccaactctatgtcacccaa 39777050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 30117904 - 30117967
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    ||||||||||||| |||| ||||||  |||| |||||||||| | |||||||||||||| ||||    
30117904 cacaagcattgtggcattatgattgaccaatatcaccaatgtcatccaactctatgtcatccaa 30117967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 92
Target Start/End: Original strand, 43225441 - 43225475
Alignment:
58 atgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||| |||||||||||||||    
43225441 atgttacccaactctatgttacccaagtgctaccc 43225475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 28 - 92
Target Start/End: Complemental strand, 7137695 - 7137631
Alignment:
28 ttgtgacattgtgattggtcaatgtcaccaatgttacccaact-ctatgtcacccaagtgctaccc 92  Q
    ||||||||||||| |||||||||||||||||| ||  |||||| | ||||||||||||| ||||||    
7137695 ttgtgacattgtggttggtcaatgtcaccaat-ttcaccaactgcaatgtcacccaagtactaccc 7137631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 29 - 94
Target Start/End: Complemental strand, 19417498 - 19417433
Alignment:
29 tgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    |||||||||||  |||  ||||||||||||||| ||| | | | ||||||||||||||||||||||    
19417498 tgtgacattgtagttgaccaatgtcaccaatgtcaccaaccacaatgtcacccaagtgctacccct 19417433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 3899901 - 3899865
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||| |||||||||||| ||||||||||    
3899901 cacaagcattgtggcattgtgattggccaatgtcacc 3899865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 61
Target Start/End: Original strand, 7009401 - 7009445
Alignment:
17 tttcacaagcattgtgacattgtgattggtcaatgtcaccaatgt 61  Q
    ||||||||||||||||| ||||||||||  |||| ||||||||||    
7009401 tttcacaagcattgtgatattgtgattgaccaatatcaccaatgt 7009445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 16971206 - 16971170
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||| |||||||||||| ||||||||||    
16971206 cacaagcattgtggcattgtgattggccaatgtcacc 16971170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 56 - 92
Target Start/End: Complemental strand, 26662434 - 26662398
Alignment:
56 caatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||| ||||||||||||||||| ||||||||||||    
26662434 caatgtcacccaactctatgtcacacaagtgctaccc 26662398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 26662461 - 26662425
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||| ||| ||||||||||||||||||||||||    
26662461 cacaagcaatgtaacattgtgattggtcaatgtcacc 26662425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 56 - 92
Target Start/End: Complemental strand, 26934029 - 26933993
Alignment:
56 caatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||| ||||||||||||||||| ||||||||||||    
26934029 caatgtcacccaactctatgtcacacaagtgctaccc 26933993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 26934056 - 26934020
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||| ||| ||||||||||||||||||||||||    
26934056 cacaagcaatgtaacattgtgattggtcaatgtcacc 26934020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 35 - 83
Target Start/End: Original strand, 39031242 - 39031290
Alignment:
35 attgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    |||||||||| ||| |||||||||||| |||| ||||||||||| ||||    
39031242 attgtgattgatcagtgtcaccaatgtcaccccactctatgtcatccaa 39031290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 59)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 48993998 - 48993907
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
48993998 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgtcacccaactctatgtcacccaagtgctaccc 48993907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 29179678 - 29179587
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||    
29179678 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcagtgtcaccaatgtcacccaactctatgtcatccaagtgctaccc 29179587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 5995426 - 5995517
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||    
5995426 cttgtgtttctctctctttcacaagcattgtggcattgtgattggtcaatgtcaccaatgtcatccaactctatgtcacccaagtgttaccc 5995517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 15220868 - 15220959
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||||| ||||||||||||||||||||| ||||||||    
15220868 cttgtgtttctctctctttcacaagcattgtgagattgtgattggccaatatcaccaatgtcacccaactctatgtcacccaaatgctaccc 15220959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 2 - 95
Target Start/End: Original strand, 29371426 - 29371519
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccctc 95  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| | ||||||||||| ||||||||| |||||    
29371426 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatatcaccaatgtcacctagctctatgtcacacaagtgctatccctc 29371519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 17127645 - 17127561
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||| |||| |||||    
17127645 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcactaatgtcacctaactctatatcacacaagt 17127561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 49444992 - 49444903
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||  |||||||||||| |||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||    
49444992 cttgtgtttctctctct--cacaagcattgtaacattgtgattgatcgatgtcaccaatgtcacccaactctatgtcacccaagtgctaccc 49444903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 32540829 - 32540755
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatg 75  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||    
32540829 cttgtgtttctctctctttcacaagcattgtgacattgtgattggccaatgccaccaatgtcacccaactctatg 32540755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 33219630 - 33219716
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgc 87  Q
    ||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||| | |||||||||||| ||||||||||    
33219630 cttgtgtttttctctctttcacaagcattatgacattgtgattgatcaatgtcaccaatgtcatccaactctatgttacccaagtgc 33219716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 93
Target Start/End: Complemental strand, 28395699 - 28395626
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    |||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||| |||||||||    
28395699 cacaagcattgtgacattgtgattggtcaatgtcaccaatgtcactcaactctatgttacccaaatgctacccc 28395626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 48993993 - 48994058
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||    
48993993 cacaagcattgtggcattgtgattggtcaatgtcaccaatgtcacccaactctatgtcacccaagt 48994058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 20 - 91
Target Start/End: Original strand, 32540824 - 32540895
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacc 91  Q
    |||||||||||| ||||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||    
32540824 cacaagcattgtaacattgtgattggtcaatgtcaccaatgtcatccaattctatgtcacccaagtgctacc 32540895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 9157372 - 9157306
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||    
9157372 cacaagcattgtgacattgtgattggtcaatgttaccaatgtcacccaactctatgtcacacaagtg 9157306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 20 - 86
Target Start/End: Complemental strand, 21630104 - 21630038
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| ||||||    
21630104 cacaagcattgtgacattgtgattggtcaatgtcaccaatgtcacccaactttatgtcacgcaagtg 21630038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 29179673 - 29179738
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||    
29179673 cacaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaagt 29179738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 37155108 - 37155043
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    |||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||    
37155108 cacaagcattgtgacattgtgattggccaatgtcaccaatgtcaccaaactctatgtcacccaagt 37155043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 741583 - 741528
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
741583 cttgtgtttctctctctttcacaagcattgtgacattgtgattgggcaatgtcacc 741528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 1819570 - 1819515
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
1819570 cttgtgtttctctctctttcacaagcattgtgacattgtgattgatcaatgtcacc 1819515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 1091620 - 1091686
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||| |||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||||    
1091620 cacaaacattgtgacattgtgattggtcaaagtcaccaatatcacccaactctatgtcacccaagtg 1091686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 27 - 85
Target Start/End: Original strand, 36290490 - 36290548
Alignment:
27 attgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||    
36290490 attgtgacattgtgattggtcaatgccaccaatgtcacccaactctatgtcacccaagt 36290548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 2 - 91
Target Start/End: Complemental strand, 28928859 - 28928779
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacc 91  Q
    |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||         |||||||||||||||||||||||||    
28928859 ttgtgtttctctctctttcacaagcactgtgacattgtgattggccaatgtcacca---------aactctatgtcacccaagtgctacc 28928779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 46932059 - 46931994
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||| ||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||    
46932059 cacaaacattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaagt 46931994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 2 - 93
Target Start/End: Original strand, 48498473 - 48498554
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    ||||||||||||||||||||||||||| || ||||||||||||||||||||||||||          |||||||||||||||||||||||||    
48498473 ttgtgtttctctctctttcacaagcatggtaacattgtgattggtcaatgtcaccaa----------ctctatgtcacccaagtgctacccc 48498554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 5 - 56
Target Start/End: Original strand, 34062270 - 34062321
Alignment:
5 tgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||    
34062270 tgtttctctctctttcacaaacattgtgacattgtgattggtcaatgtcacc 34062321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 37155103 - 37155158
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||    
37155103 cttgtgtttctctctctttcacaagtattgtgacattgtgattggccaatgtcacc 37155158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 44706860 - 44706923
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    ||||||||||| | |||||||||||| ||||||||||||||| |||||||||||||||||||||    
44706860 cacaagcattgcggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaa 44706923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 46334027 - 46333945
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||| |||||||||||||||||||||||||||||||||||         ||||||| | ||||||||||||||||||||||||||||    
46334027 cttgtgtttttctctctttcacaagcattgtgacattgtgattgg---------ccaatgtcatccaactctatgtcacccaagtgctaccc 46333945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 2 - 56
Target Start/End: Original strand, 4609054 - 4609108
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
4609054 ttgtgtttctctctctttcacaagcattgtgacattgtgattgaccaatgtcacc 4609108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 17127640 - 17127706
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    |||||||||||||||||| ||||||||||||||||| ||||| ||| |||||||| |||||||||||    
17127640 cacaagcattgtgacattttgattggtcaatgtcactaatgtcacctaactctatatcacccaagtg 17127706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 26 - 92
Target Start/End: Original strand, 46932064 - 46932129
Alignment:
26 cattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||| |||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||    
46932064 cattgtggcattgtgattggtcaatgtcaccaatgtca-ccaactctatgtcacccaagtgttaccc 46932129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 8337931 - 8337875
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaa 58  Q
    ||||||||||||||||||||||| |||||||||||||||||||  ||||||||||||    
8337931 ttgtgtttctctctctttcacaaacattgtgacattgtgattgaccaatgtcaccaa 8337875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 1091624 - 1091582
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattg 44  Q
    |||||||||||||||||||||||||||||||||||||||||||    
1091624 ttgtgtttctctctctttcacaagcattgtgacattgtgattg 1091582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 2 - 56
Target Start/End: Original strand, 47303453 - 47303507
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||||| |||||||||||||||||||  ||||||||||    
47303453 ttgtgtttctctctctttcacaaacattgtgacattgtgattgaccaatgtcacc 47303507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 89
Target Start/End: Complemental strand, 4609058 - 4608989
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    ||||| ||||||||||||||||| ||||||||||||| |||| ||||||||| || |||| |||||||||    
4609058 cacaaacattgtgacattgtgatgggtcaatgtcaccgatgtcacccaactccatatcacacaagtgcta 4608989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 5995431 - 5995366
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||| |||||| |||||||| | | |||||||||||||||||||    
5995431 cacaagcattgtggcattgtgattggccaatgttaccaatgtcatcaaactctatgtcacccaagt 5995366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 9157367 - 9157420
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtca 54  Q
    |||||||||||||||||||| |||||||||||| |||||||||| |||||||||    
9157367 cttgtgtttctctctctttctcaagcattgtgatattgtgattgatcaatgtca 9157420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 44706865 - 44706809
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgaca-ttgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||||||||||||| || |||||||||| ||||||||||    
44706865 cttgtgtttctctctctttcacaagcattgtggcatttgtgattggccaatgtcacc 44706809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 45728344 - 45728396
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtc 53  Q
    ||||||||||||||||||||||||||||| ||||||||||||||  |||||||    
45728344 cttgtgtttctctctctttcacaagcattatgacattgtgattgaccaatgtc 45728396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 75
Target Start/End: Complemental strand, 45728349 - 45728294
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatg 75  Q
    |||||||||||||| |||||||||||||||| |||||||| | |||||||||||||    
45728349 cacaagcattgtgatattgtgattggtcaatatcaccaatatcacccaactctatg 45728294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 56
Target Start/End: Complemental strand, 19711251 - 19711206
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||| ||||||| ||||||||||||||||||||||||    
19711251 tctctctttcacatgcattgtaacattgtgattggtcaatgtcacc 19711206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 56
Target Start/End: Complemental strand, 38674576 - 38674531
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||||||||||||||||| |||| |||||    
38674576 tctctctttcacaagcattgtgacattgtgattggccaatatcacc 38674531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 31342315 - 31342259
Alignment:
30 gtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    |||||||||||||||| |||||||| |  ||| ||||||||||||||||||||||||    
31342315 gtgacattgtgattggccaatgtcatcggtgtcacccaactctatgtcacccaagtg 31342259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 86
Target Start/End: Original strand, 12441018 - 12441097
Alignment:
7 tttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    |||| |||||||| ||||| ||| ||||||||||||| | ||||| ||||||||| ||| || ||||||||| |||||||    
12441018 tttccctctcttttacaaggattatgacattgtgattagccaatgccaccaatgtcaccaaattctatgtcatccaagtg 12441097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 48605028 - 48604973
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||| |||||||||||||||||||  ||||||||||||||||||  ||||||||||    
48605028 cttgcgtttctctctctttcacaaatattgtgacattgtgattgaccaatgtcacc 48604973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 54
Target Start/End: Original strand, 46334022 - 46334056
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtca 54  Q
    |||||||||||||||||||||||||||||||||||    
46334022 cacaagcattgtgacattgtgattggtcaatgtca 46334056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 22 - 92
Target Start/End: Complemental strand, 48823945 - 48823884
Alignment:
22 caagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||||| ||||||||||         |||||||||||||||||||||||||||    
48823945 caagcattgtgacattgtgattggccaatgtcacc---------caactctatgtcacccaagtgctaccc 48823884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 48498477 - 48498412
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||| |||||||  ||| ||||||  ||||||||| ||||| |||||||||||||||||||||||    
48498477 cacaaacattgtggtattatgattgaccaatgtcacaaatgtcacccaactctatgtcacccaagt 48498412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 5694969 - 5694914
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaa 58  Q
    |||||||||||||||||||||||||||| | | ||||||||||  ||||||||||||    
5694969 ttgtgtttctctctctttcacaagcatt-taatattgtgattgaccaatgtcaccaa 5694914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 93
Target Start/End: Complemental strand, 9884894 - 9884830
Alignment:
29 tgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    |||||||||||| |||  ||||||||||||||| ||| | | |||||||||| ||||||||||||    
9884894 tgtgacattgtggttgaccaatgtcaccaatgtcaccaaccactatgtcaccaaagtgctacccc 9884830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 2 - 33
Target Start/End: Complemental strand, 36290487 - 36290456
Alignment:
2 ttgtgtttctctctctttcacaagcattgtga 33  Q
    ||||||||||||||||||||||||||||||||    
36290487 ttgtgtttctctctctttcacaagcattgtga 36290456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 83
Target Start/End: Original strand, 25062024 - 25062093
Alignment:
13 tctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    ||||||||||||| ||| ||||||||| |||| |||||||||  ||| ||| |||| ||||||||||||||    
25062024 tctctttcacaagaattatgacattgtaattgatcaatgtcattaatatta-ccaattctatgtcacccaa 25062093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 92
Target Start/End: Complemental strand, 36381644 - 36381582
Alignment:
30 gtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||| ||||||||||||| | | | || ||||||||| ||||||| |||||    
36381644 gtgacattgtgattggccaatgtcaccaatatcatcgaattctatgtcatccaagtgttaccc 36381582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 55
Target Start/End: Complemental strand, 2573226 - 2573182
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcac 55  Q
    ||||| ||||||||||||||||| ||||||||| |||||| ||||    
2573226 tctctttttcacaagcattgtgatattgtgattagtcaatatcac 2573182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 8337927 - 8337963
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||| ||||||| |||||||||||||||||||||||    
8337927 cacaaacattgtggcattgtgattggtcaatgtcacc 8337963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 29 - 93
Target Start/End: Complemental strand, 9379871 - 9379807
Alignment:
29 tgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    |||||||||||| |||| |||| |||||||||| ||| | | | || ||||||||||||||||||    
9379871 tgtgacattgtggttggccaatatcaccaatgtcaccaaccacgatatcacccaagtgctacccc 9379807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 58 - 94
Target Start/End: Original strand, 26514245 - 26514281
Alignment:
58 atgttacccaactctatgtcacccaagtgctacccct 94  Q
    |||| ||||||||||||||||||||| ||||||||||    
26514245 atgtcacccaactctatgtcacccaaatgctacccct 26514281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 29371430 - 29371394
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||| |||||||||||||||||||| ||||||||||    
29371430 cacaaacattgtgacattgtgattggccaatgtcacc 29371394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 56 - 92
Target Start/End: Original strand, 44183438 - 44183474
Alignment:
56 caatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||| ||| ||||||||||||||||||||||||||    
44183438 caatgtcacctaactctatgtcacccaagtgctaccc 44183474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 49444987 - 49445023
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||| |||||||||||| ||||||||||    
49444987 cacaagcattgtggcattgtgattggccaatgtcacc 49445023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 47)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 47661899 - 47661991
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||    
47661899 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgtcacccaactctatgtcacccaaatgctacccc 47661991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 42375067 - 42375158
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||    
42375067 cttgtgtttctctctctttcacaagcattgtgacattgtgattgatcaatgtcaccaatgtcacccaactctatgtcacccaagtgctaccc 42375158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 23444350 - 23444259
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||    
23444350 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgtcacccaactctatgttacccaaatgctaccc 23444259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 51265502 - 51265593
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||    
51265502 cttgtgtttctctctctttcacaagcattgtgacattatgattggtcaatgtcaccaatgtcacccaactctaagtcacccaagtgctaccc 51265593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 6271759 - 6271850
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | || |||||||||||||||||||||||||||    
6271759 cttgtgtttctctctctttcacaagcattgtgacattgtgattggccaatgtcaccaatatcactcaactctatgtcacccaagtgctaccc 6271850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 4 - 94
Target Start/End: Original strand, 53954670 - 53954760
Alignment:
4 gtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    ||||||||| |||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||  |||||||||||||    
53954670 gtgtttctcactctttcacaagcattgtgacattgtaattggacaatgtcaccaatgtcacccaactctatgtcacaaaagtgctacccct 53954760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 35682223 - 35682301
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcac 79  Q
    ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| ||| |||||||||||||    
35682223 cttgtgtttctctatctttcacaagcattgtgacattgtgatcggtcaatgtcaccaatgtcacctaactctatgtcac 35682301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 20 - 90
Target Start/End: Original strand, 26186090 - 26186160
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctac 90  Q
    |||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
26186090 cacaagcattgtgaaattgtgattggccaatgtcatcaatgttacccaactctatgtcacccaagtgctac 26186160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 50384186 - 50384104
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||         ||||||| ||||||||||||||||||||||||||||||    
50384186 cttgtgtttctctctctttcacaagcattgtgacattgtgattgg---------ccaatgtcacccaactctatgtcacccaagtgctaccc 50384104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 2 - 92
Target Start/End: Complemental strand, 31430541 - 31430460
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||    
31430541 ttgtgtttctctctctttcataagcattgtgacattgtgattggtcaatgtc---------acccaactctatgtcacccaagtgctaccc 31430460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 51265507 - 51265442
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||    
51265507 cacaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaagt 51265442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 23444345 - 23444408
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    ||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||    
23444345 cacaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaa 23444408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 47404666 - 47404584
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||| |||||||||||||||||||||||||||||||||||||||         |||||||| ||||||||||||||||||||||||||||||    
47404666 cttgggtttctctctctttcacaagcattgtgacattgtgattg---------accaatgtcacccaactctatgtcacccaagtgctaccc 47404584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 3862622 - 3862688
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||| |||||    
3862622 cacaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacctaagtg 3862688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 3871379 - 3871445
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||| |||||    
3871379 cacaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacctaagtg 3871445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 2 - 92
Target Start/End: Original strand, 40789237 - 40789318
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||         ||||||||||||||||||||||||||    
40789237 ttgtgtttctctctctttcacaagcattgtgacattgtgattggccaatatcacca---------aactctatgtcacccaagtgctaccc 40789318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 2 - 56
Target Start/End: Original strand, 52028607 - 52028661
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
52028607 ttgtgtttctctctctttcacaagcattgtgacattgtgattggccaatgtcacc 52028661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 6271764 - 6271699
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||| ||||||||||||| | |||||||||||||||||||||||    
6271764 cacaagcattgtggcattgtgattggccaatgtcaccaatatcacccaactctatgtcacccaagt 6271699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 30 - 94
Target Start/End: Original strand, 30709986 - 30710050
Alignment:
30 gtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    |||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| ||||||    
30709986 gtgacattgtgattggccaatgtcaccaatgtcacctaactctatgtcacccaagtgccacccct 30710050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 92
Target Start/End: Complemental strand, 35682228 - 35682156
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||| ||| ||||||||||||||| ||||||||||||| | ||| ||||||||||||||||||||||||||    
35682228 cacaagtattatgacattgtgattggccaatgtcaccaatatcacctaactctatgtcacccaagtgctaccc 35682156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 2 - 68
Target Start/End: Complemental strand, 25818453 - 25818387
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaa 68  Q
    ||||||||||||||||||||||| |||||||||||||||||||  |||||||| |||||| ||||||    
25818453 ttgtgtttctctctctttcacaatcattgtgacattgtgattgaccaatgtcatcaatgtcacccaa 25818387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 44379987 - 44380069
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    |||| |||||||||| ||| | ||| ||||| |||||||||||||||||| |||||||||| || ||||||||||||||||||    
44379987 cttgcgtttctctctattttataagtattgtaacattgtgattggtcaatatcaccaatgtcactcaactctatgtcacccaa 44380069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 30861850 - 30861915
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||| ||||||||||||| | | |||||||||||||||||||||    
30861850 cacaagcattgtggcattgtgattggccaatgtcaccaatatcatccaactctatgtcacccaagt 30861915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 2 - 54
Target Start/End: Complemental strand, 28694003 - 28693951
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtca 54  Q
    ||||||||||||||||||||||| |||||||| ||||||||||||||||||||    
28694003 ttgtgtttctctctctttcacaaacattgtgatattgtgattggtcaatgtca 28693951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 5 - 56
Target Start/End: Complemental strand, 24006147 - 24006096
Alignment:
5 tgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||||||||| |||||||||||| ||||||||||    
24006147 tgtttctctctctttcacaagcattgtgtcattgtgattggccaatgtcacc 24006096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 22 - 92
Target Start/End: Complemental strand, 44379990 - 44379920
Alignment:
22 caagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||| | ||||| ||||||| ||||||| || ||||||||||||| |||||||||||||    
44379990 caagcattgtgacattataattggccaatgtcgccaatgtcactcaactctatgtcatccaagtgctaccc 44379920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 55090077 - 55090023
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcac 55  Q
    ||||||| ||||||||||||||||||||||||||||||||||||  |||||||||    
55090077 cttgtgtctctctctctttcacaagcattgtgacattgtgattgaccaatgtcac 55090023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 45591490 - 45591448
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattg 44  Q
    |||||||||||||||||||||||||||||||||||| ||||||    
45591490 ttgtgtttctctctctttcacaagcattgtgacattatgattg 45591448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 5 - 59
Target Start/End: Original strand, 47762669 - 47762723
Alignment:
5 tgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaat 59  Q
    ||||||||||||||||||||||||||||||||| || |||  |||||||||||||    
47762669 tgtttctctctctttcacaagcattgtgacattatggttgaccaatgtcaccaat 47762723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 56
Target Start/End: Complemental strand, 26186087 - 26186042
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||||||||||||||||  ||||||||||    
26186087 tctctctttcacaagcattgtgacattgtgattgaccaatgtcacc 26186042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 5 - 85
Target Start/End: Original strand, 38714884 - 38714964
Alignment:
5 tgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||| | |||||||||| ||||||||||||| ||||||  ||| |||||||||| ||||| || ||||||| ||||||    
38714884 tgtttctatttctttcacaaacattgtgacattgagattgggtaatatcaccaatgtcacccatctatatgtcatccaagt 38714964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 47661904 - 47661856
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaa 68  Q
    ||||||||||||| |||||||||||| ||||||||||||||| ||||||    
47661904 cacaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaa 47661856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 28 - 86
Target Start/End: Original strand, 5048884 - 5048942
Alignment:
28 ttgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    |||||||||| ||||||  |||||||| |||||| |||||||||||||||| |||||||    
5048884 ttgtgacattatgattgaccaatgtcatcaatgtcacccaactctatgtcatccaagtg 5048942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 33 - 86
Target Start/End: Original strand, 2325069 - 2325122
Alignment:
33 acattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||||| |||||||||| |||||| ||| ||||||||||||| ||||||    
2325069 acattgtgatttgtcaatgtcatcaatgtcaccaaactctatgtcactcaagtg 2325122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 47762664 - 47762607
Alignment:
26 cattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    |||||| ||||||||||||||||||||||| ||| | || || |||||||||||||||    
47762664 cattgtaacattgtgattggtcaatgtcacaaatatcactcagctctatgtcacccaa 47762607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 30861855 - 30861823
Alignment:
1 cttgtgtttctctctctttcacaagcattgtga 33  Q
    |||||||||||||||||||||||||||||||||    
30861855 cttgtgtttctctctctttcacaagcattgtga 30861823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 93
Target Start/End: Original strand, 31846896 - 31846960
Alignment:
29 tgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    |||||||||||| |||| |||| |||||||||| ||| | | | |||||||||||||||||||||    
31846896 tgtgacattgtggttggccaatatcaccaatgtcaccaaccacaatgtcacccaagtgctacccc 31846960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 56
Target Start/End: Original strand, 17285807 - 17285842
Alignment:
21 acaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||| ||||||||||||||||||||||||||||||    
17285807 acaagtattgtgacattgtgattggtcaatgtcacc 17285842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 91
Target Start/End: Original strand, 46321439 - 46321502
Alignment:
28 ttgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacc 91  Q
    ||||||||||||| |||||||||||||||||| | ||| | | | ||||||| |||||||||||    
46321439 ttgtgacattgtggttggtcaatgtcaccaatatcaccaaccacaatgtcactcaagtgctacc 46321502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 22592960 - 22592918
Alignment:
17 tttcacaagcattgtgacattgtgattggtcaatgtcaccaat 59  Q
    ||||||||  || ||||||||||||||||||||||||||||||    
22592960 tttcacaaagatcgtgacattgtgattggtcaatgtcaccaat 22592918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 58
Target Start/End: Complemental strand, 40789241 - 40789203
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaa 58  Q
    ||||| |||||||||||||||||||| ||||||||||||    
40789241 cacaaacattgtgacattgtgattggccaatgtcaccaa 40789203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 56 - 89
Target Start/End: Original strand, 24006165 - 24006198
Alignment:
56 caatgttacccaactctatgtcacccaagtgcta 89  Q
    |||||| |||||||||||||||||||||||||||    
24006165 caatgtcacccaactctatgtcacccaagtgcta 24006198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 7 - 56
Target Start/End: Complemental strand, 49469983 - 49469934
Alignment:
7 tttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||  ||||||||| |||||||| ||| |||||||    
49469983 tttctctctctttcacaataattgtgacactgtgattgatcattgtcacc 49469934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 83
Target Start/End: Original strand, 337047 - 337098
Alignment:
31 tgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    |||||||||| ||||||||||||| |||||||||| ||  |||||||||||||    
337047 tgacattgtggttggtcaatgtca-caatgttaccaaatactatgtcacccaa 337098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 61
Target Start/End: Original strand, 31532766 - 31532806
Alignment:
21 acaagcattgtgacattgtgattggtcaatgtcaccaatgt 61  Q
    |||| ||||||||| ||||||||||||||||||||| ||||    
31532766 acaaacattgtgacgttgtgattggtcaatgtcacctatgt 31532806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 59
Target Start/End: Original strand, 36118323 - 36118351
Alignment:
31 tgacattgtgattggtcaatgtcaccaat 59  Q
    |||||||||||||||||||||||||||||    
36118323 tgacattgtgattggtcaatgtcaccaat 36118351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 56
Target Start/End: Complemental strand, 53954668 - 53954636
Alignment:
24 agcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||| ||||||||||    
53954668 agcattgtgacattgtgattggccaatgtcacc 53954636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 33)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 16514481 - 16514573
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||    
16514481 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatctcacccaactctatgtcacccaagtgctacccc 16514573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 38933644 - 38933735
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||    
38933644 cttgtgtttctctctctttcacaagcattgtgacattatgattggccaacgtcaccaatgtcacccaactctatgtcacccaagtgctaccc 38933735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 2 - 95
Target Start/End: Complemental strand, 14470672 - 14470579
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccctc 95  Q
    |||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||||    
14470672 ttgtgtttctctctctttcacaagcattgcaacattgtgattggtcaatgtcaccaatgtcacccaactctatgtcacacaagtgctatccctc 14470579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 2 - 84
Target Start/End: Complemental strand, 6217304 - 6217222
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaag 84  Q
    ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||    
6217304 ttgtgtttctctctctttcacaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaag 6217222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 29508772 - 29508678
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacatt-gtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||||||||||||||||| ||||| |||||||    
29508772 cttgtgtttctctctctttcacaagcattgtggcatttgtgattggtcaatgtcaccaatgtcacccaactctatgtcacctaagtgttacccct 29508678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 6722008 - 6722101
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    |||||||||||||||||||||||| |||||||||||||||||||| |||| |||| ||||| | ||||||||||||||||||||||||||||||    
6722008 cttgtgtttctctctctttcacaaacattgtgacattgtgattggccaatatcactaatgtcaaccaactctatgtcacccaagtgctacccct 6722101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 2 - 93
Target Start/End: Original strand, 37961764 - 37961855
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| | || ||||||||||||||||||||| ||||||    
37961764 ttgtgtttctctctctttcacaagcattgtggcattgtgattggtcaatgtcacaaatatcactcaactctatgtcacccaagtgttacccc 37961855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 14229434 - 14229355
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacc 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||| ||| ||||||||||||||    
14229434 cttgtgtttctctctctttcacaagcattgtgacattgtgattgaccaatgtcaccaatgtcaccgaactctatgtcacc 14229355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 2 - 92
Target Start/End: Original strand, 14892318 - 14892408
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||| ||||||||||||||| ||| ||||| |||||||||||| |||||||||||||||| | ||||||||||||||||||| ||||||||    
14892318 ttgtctttctctctctttcataagtattgtaacattgtgattgatcaatgtcaccaatgtcatccaactctatgtcacccaaatgctaccc 14892408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 11 - 89
Target Start/End: Original strand, 32545855 - 32545933
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    ||||||||||| ||||||||||||||| ||||||| ||||||||||||||| ||  |||||||||||||||||||||||    
32545855 tctctctttcataagcattgtgacattatgattggccaatgtcaccaatgtcactaaactctatgtcacccaagtgcta 32545933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 2 - 55
Target Start/End: Original strand, 15011338 - 15011391
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcac 55  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||    
15011338 ttgtgtttctctctctttcacaagcattgtgacattgtgattggccaatgtcac 15011391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 2828641 - 2828696
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||    
2828641 cttgtgtttctctctctttcagaagcattgtgacattgtgattggccaatgtcacc 2828696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 2 - 72
Target Start/End: Complemental strand, 29925650 - 29925580
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactct 72  Q
    |||||||||||||||||||||||||||| |||||||||||  || ||||||||||||| | ||||||||||    
29925650 ttgtgtttctctctctttcacaagcattctgacattgtgaggggccaatgtcaccaatatcacccaactct 29925580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 37762082 - 37762028
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcac 55  Q
    ||||||||||| |||||||||||||||||| ||||||||||||||||||||||||    
37762082 cttgtgtttctttctctttcacaagcattgcgacattgtgattggtcaatgtcac 37762028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 16514486 - 16514421
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    |||||||||| || ||| |||||||| ||||||||||||||| |||||||||||||||||||||||    
16514486 cacaagcattatggcatagtgattggccaatgtcaccaatgtcacccaactctatgtcacccaagt 16514421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 29508767 - 29508832
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||| | |||||||||||| ||||||||||||| | |||||||||||||||||||||||    
29508767 cacaagcattgcggcattgtgattggccaatgtcaccaatatcacccaactctatgtcacccaagt 29508832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 80
Target Start/End: Original strand, 9173058 - 9173117
Alignment:
21 acaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacc 80  Q
    |||||||||||| |||||||||||| |||| |||||||||| ||||||||||||||||||    
9173058 acaagcattgtggcattgtgattggccaatatcaccaatgtcacccaactctatgtcacc 9173117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 3 - 86
Target Start/End: Original strand, 24115979 - 24116062
Alignment:
3 tgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    |||||||| | ||||||||||||||||| |||||||||||||  |||| |||| ||||  ||||||||||||||||| ||||||    
24115979 tgtgtttcacactctttcacaagcattgcgacattgtgattgaccaatatcactaatggcacccaactctatgtcacacaagtg 24116062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 33018620 - 33018679
Alignment:
19 tcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtca 78  Q
    ||||||||||||||||||||||||||  |||| |||||||||| ||||||||||||||||    
33018620 tcacaagcattgtgacattgtgattgaccaatatcaccaatgtcacccaactctatgtca 33018679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 45213892 - 45213942
Alignment:
36 ttgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||||||||||||| |||||| ||||||||||||||||| ||||||    
45213892 ttgtgattggtcaatgtcatcaatgtcacccaactctatgtcacacaagtg 45213942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 2894020 - 2894073
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtca 54  Q
    ||||| ||||||||||||||||||||||||||||| ||||||||  ||||||||    
2894020 cttgtatttctctctctttcacaagcattgtgacactgtgattgaccaatgtca 2894073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 61
Target Start/End: Complemental strand, 6722013 - 6721972
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgt 61  Q
    |||||||||||||| |||||||||||||||||||||||||||    
6722013 cacaagcattgtgatattgtgattggtcaatgtcaccaatgt 6721972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 89
Target Start/End: Complemental strand, 24115982 - 24115913
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    |||| ||||||| ||||||||||||| |||||| |||||||| || ||||||||| |||| |||||||||    
24115982 cacaggcattgtaacattgtgattggccaatgttaccaatgtgactcaactctatctcacacaagtgcta 24115913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 91
Target Start/End: Complemental strand, 39819116 - 39819054
Alignment:
29 tgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacc 91  Q
    |||||||||||| |||| ||||||||||||||| ||| | | | |||||||||||||||||||    
39819116 tgtgacattgtggttggccaatgtcaccaatgtcaccaaccacaatgtcacccaagtgctacc 39819054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 38933649 - 38933613
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||| |||||||||||||||||||||||    
38933649 cacaagcattgtggcattgtgattggtcaatgtcacc 38933613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 55 - 94
Target Start/End: Complemental strand, 2893999 - 2893960
Alignment:
55 ccaatgttacccaactctatgtcacccaagtgctacccct 94  Q
    ||||||| |||||||||||||||||||||||| |||||||    
2893999 ccaatgtcacccaactctatgtcacccaagtgttacccct 2893960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 8534204 - 8534246
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattg 44  Q
    |||||||||||||| ||||||||| ||||||||||||| ||||    
8534204 ttgtgtttctctctatttcacaagaattgtgacattgtaattg 8534246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 32545840 - 32545782
Alignment:
28 ttgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||| ||| |||  ||||||||||||||| ||| |||||||||||||| |||||    
32545840 ttgtgacatcgtggttgaccaatgtcaccaatgtcacctaactctatgtcacctaagtg 32545782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 55 - 92
Target Start/End: Original strand, 14229454 - 14229491
Alignment:
55 ccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||| | ||||||||||||||||||||||||||||    
14229454 ccaatgtcatccaactctatgtcacccaagtgctaccc 14229491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 37633025 - 37632988
Alignment:
48 aatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    |||||||||||||| ||| |||||||||||||||||||    
37633025 aatgtcaccaatgtcaccaaactctatgtcacccaagt 37632988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 2828646 - 2828610
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||| ||||||||||||||| ||||||||||    
2828646 cacaagcattttgacattgtgattggccaatgtcacc 2828610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 14464622 - 14464582
Alignment:
15 tctttcacaagcattgtgacattgtgattggtcaatgtcac 55  Q
    ||||||||||| ||||||||||||||||||  |||||||||    
14464622 tctttcacaagtattgtgacattgtgattgaccaatgtcac 14464582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 15011342 - 15011294
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaa 68  Q
    ||||| ||||||| |||||||||||| |||| |||||||||| ||||||    
15011342 cacaaacattgtggcattgtgattggccaatatcaccaatgtcacccaa 15011294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 29)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 11016926 - 11017017
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
11016926 cttgtgtttctctctctttcacaaacattgtgacattgtgattggtcaatgtcaccaatgtcacccaactctatgtcacccaagtgctaccc 11017017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 92
Target Start/End: Original strand, 4290605 - 4290693
Alignment:
4 gtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||    
4290605 gtgtttctctctctttcacaagaattgtgacattgtgattggccaatgtcaccaatgtcacccaactgtatgtcacccaagtgctaccc 4290693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 5 - 93
Target Start/End: Original strand, 42628356 - 42628444
Alignment:
5 tgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    |||||||||||||||||||||||||| |||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||||||    
42628356 tgtttctctctctttcacaagcattgggacattgtgattggccaatatcaccaatgtcacccaactctatgtcacccaagtgctacccc 42628444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 2 - 92
Target Start/End: Original strand, 48000795 - 48000885
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||||  ||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||    
48000795 ttgtgtttctctctctttcacagacattgtggcattgtgattggtcaatgtcaccaatgtcacccaactctatgtgacccaagtgttaccc 48000885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 7 - 85
Target Start/End: Complemental strand, 48000769 - 48000691
Alignment:
7 tttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    |||||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||||| |||||||||||||    
48000769 tttctctctctttcacaagcattgtggcattgtgattgatcaatgtcaccaatgtcacccaactcaatgtcacccaagt 48000691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 2 - 61
Target Start/End: Original strand, 15027600 - 15027659
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgt 61  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15027600 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgt 15027659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 38975862 - 38975953
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||||||||||||| |||| | |||| |||||||||||||||| ||| |||||||||||||| ||||| |||||    
38975862 cttgtgtttctctctctttcacaagcattgtggcattataattgatcaatgtcaccaatgtcacctaactctatgtcacctaagtgttaccc 38975953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 23 - 85
Target Start/End: Original strand, 41018307 - 41018369
Alignment:
23 aagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    |||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||    
41018307 aagcattgtggcattgtgattggtcaatgtcaccaatgtcacccaactctatgtcacccaagt 41018369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 11016931 - 11016866
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||    
11016931 cacaagcattgtggcattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaagt 11016866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 23 - 85
Target Start/End: Original strand, 45231929 - 45231991
Alignment:
23 aagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||    
45231929 aagcattgtaacattgtgattggccaatgtcaccaatgtcacccaactctatgtcacccaagt 45231991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 91
Target Start/End: Complemental strand, 27028790 - 27028719
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacc 91  Q
    |||||||||||||||||||||||||  ||||||||||||||| || ||||| ||||||||| ||||||||||    
27028790 cacaagcattgtgacattgtgattgtccaatgtcaccaatgtcactcaactatatgtcaccaaagtgctacc 27028719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 2 - 89
Target Start/End: Complemental strand, 27028873 - 27028795
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    |||||||||||||||||||| ||||||||||||||||||||||          |||||||||||||||||||||||||||||||||||    
27028873 ttgtgtttctctctctttcagaagcattgtgacattgtgattg---------tccaatgttacccaactctatgtcacccaagtgcta 27028795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 85
Target Start/End: Original strand, 34854771 - 34854836
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||| ||||||| |||||||||||  ||||||||||||||| |||||||||||||||||||||||    
34854771 cacaaacattgtggcattgtgattgaccaatgtcaccaatgtcacccaactctatgtcacccaagt 34854836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 38975867 - 38975802
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||| |||||||||||  |||||| |||||||| |||||||||||||||||||||||    
38975867 cacaagcattgtggcattgtgattgaccaatgttaccaatgtcacccaactctatgtcacccaagt 38975802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 29053394 - 29053338
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaa 58  Q
    ||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||    
29053394 ttgtgtttctctctctttcacaagcattgaggcattgtgattggccaatgtcaccaa 29053338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 34854775 - 34854719
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaa 58  Q
    |||||||||| |||||||||||||||||||| |||||||||||| ||||||||||||    
34854775 ttgtgtttctatctctttcacaagcattgtggcattgtgattggccaatgtcaccaa 34854719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 5 - 56
Target Start/End: Complemental strand, 41018305 - 41018254
Alignment:
5 tgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||||||| |||||||||||||| ||||||||||    
41018305 tgtttctctctctttcacaagcattgggacattgtgattggccaatgtcacc 41018254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 2 - 56
Target Start/End: Complemental strand, 7671991 - 7671937
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||||||||||||| ||||||||||||  |||||||||    
7671991 ttgtgtttctctctctttcacaagcattgtggcattgtgattggctaatgtcacc 7671937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 86
Target Start/End: Original strand, 41945924 - 41945997
Alignment:
13 tctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    ||||||||||||||||||| ||||||||||||  |||| | |||||||| || ||||| |||||||||||||||    
41945924 tctctttcacaagcattgtaacattgtgattgaccaatattaccaatgtcactcaactttatgtcacccaagtg 41945997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 4290603 - 4290542
Alignment:
24 agcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||| |||||||||||  |||| |||||||| | |||||||||||||||||||||||    
4290603 agcattgtggcattgtgattgaccaatatcaccaatatcacccaactctatgtcacccaagt 4290542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 4649387 - 4649436
Alignment:
9 tctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaa 58  Q
    |||||||||||||||||||| |||||||||||||||  ||||||||||||    
4649387 tctctctctttcacaagcatcgtgacattgtgattgaccaatgtcaccaa 4649436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 10419515 - 10419572
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaa 58  Q
    |||||||||||||||||||||||||  |||||||||||||||  | ||||||||||||    
10419515 cttgtgtttctctctctttcacaagttttgtgacattgtgatcagccaatgtcaccaa 10419572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 20 - 85
Target Start/End: Complemental strand, 15027604 - 15027539
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||| |||||||  ||||||||||||||||||||||||||| |  ||||||||||| ||||||||    
15027604 cacaaacattgtggtattgtgattggtcaatgtcaccaatgtcaaacaactctatgttacccaagt 15027539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 27028869 - 27028929
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacc 80  Q
    ||||| |||||||||||||||||||  ||||||||||||  | |||||| |||||||||||    
27028869 cacaaacattgtgacattgtgattgaccaatgtcaccaacatcacccaagtctatgtcacc 27028929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 22764776 - 22764817
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgt 61  Q
    ||||| |||||||||||||||||||| |||| ||||||||||    
22764776 cacaaacattgtgacattgtgattggccaatatcaccaatgt 22764817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 11 - 56
Target Start/End: Complemental strand, 41084251 - 41084206
Alignment:
11 tctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||| ||||||| ||| |||||| |||||||||||    
41084251 tctctctttcacaaggattgtgatattatgattgatcaatgtcacc 41084206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 23 - 56
Target Start/End: Complemental strand, 42628354 - 42628321
Alignment:
23 aagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||| |||||||||||||||||||||||    
42628354 aagcattgtggcattgtgattggtcaatgtcacc 42628321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 6225600 - 6225529
Alignment:
7 tttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcac 79  Q
    ||||||||||||||| ||| |  ||||||||||||||| | ||||||| |||||| | |||| ||||||||||    
6225600 tttctctctctttcataaggaccgtgacattgtgattgattaatgtcatcaatgtca-ccaattctatgtcac 6225529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 56 - 92
Target Start/End: Complemental strand, 45231889 - 45231853
Alignment:
56 caatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||| |||||||||||||||||||||||| |||||    
45231889 caatgtcacccaactctatgtcacccaagtgttaccc 45231853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 49784 - 49693
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||    
49784 cttgtgtttctctttctttcacaagcattgtgacattgtgattggtcaatgtcatcaatgtcacccaactctatgtcacccaagtgctaccc 49693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Original strand, 49779 - 49815
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||| |||||||||||| ||||||||||    
49779 cacaagcattgtggcattgtgattggccaatgtcacc 49815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 72; Significance: 8e-33; HSPs: 17)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 24618682 - 24618591
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||||||||||||||||| ||||||| |||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||    
24618682 cttgtgtttctctctctttcataagcattatgacattgtgattgatcaatgtcaccaatgtcacccaactctatgtcactcaagtgctaccc 24618591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 13043514 - 13043606
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctacccc 93  Q
    ||||||||||||||||||||||||||||||||| ||||||||| | ||||||||||||| | || |||||||||||||||||| |||||||||    
13043514 cttgtgtttctctctctttcacaagcattgtgatattgtgattagccaatgtcaccaatatcactcaactctatgtcacccaaatgctacccc 13043606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 12343157 - 12343232
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgt 76  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||    
12343157 cttgtgtttctctctctttcacaagcattgtgacattgtgattggccaatgtcaccaatctcacccaactctatgt 12343232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 2 - 92
Target Start/End: Original strand, 17750960 - 17751050
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||| ||| |||||||||||||||||||||||||||||||| || |||||||| |||| | ||||||||||||||||| ||||||||||||    
17750960 ttgtatttatctctctttcacaagcattgtgacattgtgatcggccaatgtcatcaatatcacccaactctatgtcacacaagtgctaccc 17751050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 92
Target Start/End: Complemental strand, 24587523 - 24587451
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    |||||||||||||||||||||||||  ||||||||| ||||| |||||||||||||||||| |||||||||||    
24587523 cacaagcattgtgacattgtgattgaccaatgtcactaatgtcacccaactctatgtcacctaagtgctaccc 24587451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 10521930 - 10521873
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaa 58  Q
    ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||    
10521930 cttgtgtttctctctctttcataagcattgtgacattgtgattggccaatgtcaccaa 10521873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 18 - 92
Target Start/End: Complemental strand, 7384552 - 7384478
Alignment:
18 ttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgctaccc 92  Q
    ||||||| |||| ||||||||||||||||||||||||| ||||| | |||||||||| ||||| |||||||||||    
7384552 ttcacaaacattatgacattgtgattggtcaatgtcactaatgtcatccaactctatatcacctaagtgctaccc 7384478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 24975815 - 24975749
Alignment:
19 tcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    |||||||||||||| |||||||||||  ||||||||||||||| | |||||||||||||||||||||    
24975815 tcacaagcattgtggcattgtgattgaccaatgtcaccaatgtcagccaactctatgtcacccaagt 24975749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 551246 - 551191
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||||| ||||||| |||||||||||  ||||||||||    
551246 cttgtgtttctctctctttcacaaacattgtggcattgtgattgaccaatgtcacc 551191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 83
Target Start/End: Original strand, 551241 - 551304
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaa 83  Q
    ||||||||||||| |||||||||||| ||||||||||||| | | |||| ||||||||||||||    
551241 cacaagcattgtggcattgtgattggccaatgtcaccaatatcatccaattctatgtcacccaa 551304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 5 - 56
Target Start/End: Complemental strand, 2315381 - 2315330
Alignment:
5 tgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||| ||||||||||||| ||||||||||||||||||| |||||||||||    
2315381 tgtttcgctctctttcacaaacattgtgacattgtgattgatcaatgtcacc 2315330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 21 - 89
Target Start/End: Complemental strand, 17750963 - 17750896
Alignment:
21 acaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    |||| |||||||||||||||||||  ||||||||||||||| |  |||||||||||||| |||||||||    
17750963 acaaacattgtgacattgtgattgaccaatgtcaccaatgtca-tcaactctatgtcacacaagtgcta 17750896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 89
Target Start/End: Original strand, 24618677 - 24618737
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    |||||||||||||||||||||||||||||| |||         |||||||||||||||||||||||||||    
24618677 cacaagcattgtgacattgtgattggtcaacgtc---------acccaactctatgtcacccaagtgcta 24618737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 24587518 - 24587558
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtga 41  Q
    |||||||||||| || |||||||||||||||||||||||||    
24587518 cttgtgtttctcgctttttcacaagcattgtgacattgtga 24587558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 31654367 - 31654331
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||||||| ||||||||||    
31654367 cacaagcattgtgacattgtgattggccaatgtcacc 31654331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 6299208 - 6299162
Alignment:
49 atgtcaccaatgttacccaactc-tatgtcacccaagtgctacccct 94  Q
    ||||||||||||| ||||||||| |||||||| ||||||||||||||    
6299208 atgtcaccaatgtcacccaactcttatgtcacacaagtgctacccct 6299162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 94
Target Start/End: Complemental strand, 6306018 - 6305972
Alignment:
49 atgtcaccaatgttacccaactc-tatgtcacccaagtgctacccct 94  Q
    ||||||||||||| ||||||||| |||||||| ||||||||||||||    
6306018 atgtcaccaatgtcacccaactcttatgtcacacaagtgctacccct 6305972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0586 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: scaffold0586
Description:

Target: scaffold0586; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 7128 - 7050
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcac 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||  ||| |||||||||| |||||||||||||||||    
7128 cttgtgtttctctctctttcacaagcattgtgacattgtgattggctaatatcaccaatgtcacccaactctatgtcac 7050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0586; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 7123 - 7188
Alignment:
20 cacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtg 86  Q
    |||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||| ||||||    
7123 cacaagcattgtgacattgtgattggccaatgtcaccaatgtca-ccaactctatgtcacacaagtg 7188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0161 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: scaffold0161
Description:

Target: scaffold0161; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 5 - 85
Target Start/End: Complemental strand, 27297 - 27217
Alignment:
5 tgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    ||||||||||||||||||||| ||| ||||||||||||||| |||| |||| ||||| |||||||||||||||||||||||    
27297 tgtttctctctctttcacaagaattatgacattgtgattggccaatatcactaatgtcacccaactctatgtcacccaagt 27217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0161; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 23 - 85
Target Start/End: Original strand, 27299 - 27361
Alignment:
23 aagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagt 85  Q
    |||||||||| |||||||||||| |||| |||||||||| |||||||||||| ||||||||||    
27299 aagcattgtggcattgtgattggccaatatcaccaatgtcacccaactctatatcacccaagt 27361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 2 - 89
Target Start/End: Complemental strand, 19202 - 19115
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgttacccaactctatgtcacccaagtgcta 89  Q
    |||||||||||| |||| ||||||||||||||||||||||||| ||||| ||| |||||| ||||||||||||||||| ||| |||||    
19202 ttgtgtttctctttcttccacaagcattgtgacattgtgattgatcaatatcatcaatgtcacccaactctatgtcacacaaatgcta 19115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0047 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0047
Description:

Target: scaffold0047; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 2 - 56
Target Start/End: Original strand, 63815 - 63869
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
63815 ttgtgtttctctctctttcacaagcattgtgacattgtgattggccaatgtcacc 63869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1033 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold1033
Description:

Target: scaffold1033; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 2270 - 2322
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtc 53  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||    
2270 cttgtgtttctctctctttcacaagcattgtgacattgtgattgatcaatgtc 2322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1029 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold1029
Description:

Target: scaffold1029; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 2270 - 2322
Alignment:
1 cttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtc 53  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||    
2270 cttgtgtttctctctctttcacaagcattgtgacattgtgattgatcaatgtc 2322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0481 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: scaffold0481
Description:

Target: scaffold0481; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 2 - 56
Target Start/End: Complemental strand, 2967 - 2913
Alignment:
2 ttgtgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcacc 56  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||    
2967 ttgtgtttctctctctttcacaaacattgtgacattgtgattggtcaatatcacc 2913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0536 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0536
Description:

Target: scaffold0536; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 61
Target Start/End: Complemental strand, 4969 - 4913
Alignment:
5 tgtttctctctctttcacaagcattgtgacattgtgattggtcaatgtcaccaatgt 61  Q
    ||||| ||||||||||||||||||||| | ||||||||||||| |||||||||||||    
4969 tgtttgtctctctttcacaagcattgtaatattgtgattggtcgatgtcaccaatgt 4913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University