View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7708_low_39 (Length: 260)

Name: NF7708_low_39
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7708_low_39
NF7708_low_39
[»] chr5 (1 HSPs)
chr5 (5-104)||(31860488-31860587)
[»] chr3 (1 HSPs)
chr3 (142-231)||(51635159-51635244)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 5 - 104
Target Start/End: Complemental strand, 31860587 - 31860488
Alignment:
5 aacacataacagtctttgaaaagtcgaacgatagttaactgctgttgagtcaacgacagtcgacaaaaagtagtttgagaagtaagaaaagtaatatcca 104  Q
    ||||| ||| |||||||||||| ||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31860587 aacacttaatagtctttgaaaaatcgaacgatggttaaccgccgttgagtcaacgacagtcgacaaaaagtagtttgagaagtaagaaaagtaatatcca 31860488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 142 - 231
Target Start/End: Original strand, 51635159 - 51635244
Alignment:
142 gtgaaccggttcttgaaagtaccgcgaaccggtacgtacaaaccggggattggcagtttgctacagtgttacacgaattatgttactatg 231  Q
    |||||||||||||  |||||||||||||||||| | ||| ||||||   || || ||| ||||||||| |||||||||||||| ||||||    
51635159 gtgaaccggttctcaaaagtaccgcgaaccggttcatacgaaccgg---tttgcggttcgctacagtg-tacacgaattatgtgactatg 51635244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University