View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708_low_42 (Length: 251)
Name: NF7708_low_42
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 102 - 235
Target Start/End: Complemental strand, 24307130 - 24306998
Alignment:
| Q |
102 |
caacaacaatgatttgggctttgagttggagtgaggttggtgtctcttttaaatggttatgttttggtttagtcgggatatttgcaattgttatgttttg |
201 |
Q |
| |
|
||||||||||| |||||| | || |||||||||| ||||||||||||| ||||||||||| ||||||| ||||||| || | |||||| ||||||||||| |
|
|
| T |
24307130 |
caacaacaatggtttgggttgtgcgttggagtgacgttggtgtctcttctaaatggttat-ttttggtgtagtcggtatgtctgcaatggttatgttttg |
24307032 |
T |
 |
| Q |
202 |
ctttagtcgggatgtctgcagctgcagaaggaat |
235 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
24307031 |
cgttagtcgggatgtctgcagctgcagaaggaat |
24306998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 102 - 235
Target Start/End: Original strand, 24366190 - 24366322
Alignment:
| Q |
102 |
caacaacaatgatttgggctttgagttggagtgaggttggtgtctcttttaaatggttatgttttggtttagtcgggatatttgcaattgttatgttttg |
201 |
Q |
| |
|
||||||||||| |||||| | || |||||||||| ||||||||||||| ||||||||||| ||||||| ||||||| || | |||||| ||||||||||| |
|
|
| T |
24366190 |
caacaacaatggtttgggttgtgcgttggagtgacgttggtgtctcttctaaatggttat-ttttggtgtagtcggtatgtctgcaatggttatgttttg |
24366288 |
T |
 |
| Q |
202 |
ctttagtcgggatgtctgcagctgcagaaggaat |
235 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
24366289 |
cgttagtcgggatgtctgcagctgcagaaggaat |
24366322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University