View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708_low_46 (Length: 241)
Name: NF7708_low_46
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 30198196 - 30197987
Alignment:
| Q |
15 |
tgttgatttgaaagagtcctcacataatccaaactttcatgttgattgttgctcatgagtggctgcttgctaattatcatagaagtagatgaggacttga |
114 |
Q |
| |
|
|||||| ||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
30198196 |
tgttgagttgaaggagtcctcatataatccaaactttcatgttgtttgttgctcatgagtggctggttactaattatcatagaagtagatgaggacttga |
30198097 |
T |
 |
| Q |
115 |
agttttactcacttgttctccttgtcgaaatacaaatgaaacaatcatccatgttctaagatattgtgtttaaccaacctagatttggatcatgttaatt |
214 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30198096 |
agttttactcacctgttctccttgtcgaaatacaaatgaaacaatcatccatgttctaagatattgtgtttaaccaacctagatttggatcatgttaatt |
30197997 |
T |
 |
| Q |
215 |
gaacagtact |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
30197996 |
gaacagtact |
30197987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 65
Target Start/End: Original strand, 11142105 - 11142148
Alignment:
| Q |
22 |
ttgaaagagtcctcacataatccaaactttcatgttgattgttg |
65 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||| |||||||| |
|
|
| T |
11142105 |
ttgaaagagtcctcacaaaatccaaacattcatgtggattgttg |
11142148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University