View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708_low_47 (Length: 240)
Name: NF7708_low_47
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 225
Target Start/End: Original strand, 51340736 - 51340945
Alignment:
| Q |
17 |
attaattgtgtatttagaggttcatctaatcatgcagcatgttgtggtatttttagaagtagaaattcagcctcctttgacaattttatttttcatgttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51340736 |
attaattgtgtatttagaggttcatctaatcatgcagcatgttgtggtatttttagaagtagaaattcagcctccattgacaattttatttttcatgttt |
51340835 |
T |
 |
| Q |
117 |
tctattt-atgtagagcattatggtgcaattttggctattaagataactcattaaaaaggttgaaaacttattctcaacttcttgttttagctttcacca |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51340836 |
tctattttatgtagagcattatggtgcaattttggctattaagataactcattaaaaaggttgaaaacttattctcaacttcttgttttagctttcacca |
51340935 |
T |
 |
| Q |
216 |
atcaatttgt |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
51340936 |
atcaatttgt |
51340945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University