View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708_low_48 (Length: 239)
Name: NF7708_low_48
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 1184858 - 1185079
Alignment:
| Q |
1 |
taacttatactgtgacattttgtatcataaagctagttatatctattgcccaattacattaaggatgaaatatatttcttcttggtcaaagttttagcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1184858 |
taacttatactgtgacattttgtatcataaagctaattatatctattgcccaattacattaaggatgaaatatatttcttcttggtcaaagttttagcac |
1184957 |
T |
 |
| Q |
101 |
taaagagatacttacagttagtgtgtagcagatgggtaactgctcatggatcattctcgcaacttgagggttttttcttgcgcctgcggcttgggaagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1184958 |
taaagagatacttacagttagtgtgtagcagatgggtaactgctcatggatcattctcgcaacttgagggttttttcttgcgcctgcggcttgggaagtg |
1185057 |
T |
 |
| Q |
201 |
ggaagaagggcttggaggaact |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1185058 |
ggaagaagggcttggaggaact |
1185079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 16992940 - 16992867
Alignment:
| Q |
1 |
taacttatactgtgacattttgtatcataaagctagttatatctattgcccaattacattaaggatgaaatata |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16992940 |
taacttatactgtgacattttgtatcataaagctagttatatctattgcccaattacattaaggatgaaatata |
16992867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University