View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708_low_49 (Length: 238)
Name: NF7708_low_49
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 30 - 224
Target Start/End: Complemental strand, 22042746 - 22042553
Alignment:
| Q |
30 |
ataactacatcatctttaactactctttccacttgaaatggctggatatcgtgatgtgcttaaaagacaagttctgggaggttttgaaactgtacatctt |
129 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||| |||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
22042746 |
ataactacatcatctttaacaactctttccacttcaaatggctggatatcgtgttgtacttaaaagacaaattctaggaggttttgaaactgtacatctt |
22042647 |
T |
 |
| Q |
130 |
ccatatcaggtattctatattttcagttttcctaactgctaattttattttgttttactactctgcagtgttgttatacttcttcaatgtgcaca |
224 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| | | ||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22042646 |
ccatatcaggtattctatattttcagctttcctaactgct-ctgcactgttgttatactactctgcactgttgttatacttcttcaatgtgcaca |
22042553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 30244804 - 30244775
Alignment:
| Q |
1 |
agaaaagtggtcaaaatttgaggtatgaca |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30244804 |
agaaaagtggtcaaaatttgaggtatgaca |
30244775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University