View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708_low_57 (Length: 213)
Name: NF7708_low_57
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 11 - 199
Target Start/End: Original strand, 43298526 - 43298714
Alignment:
| Q |
11 |
tttggtgttaatggaattgtatttctagagtaaaaacctctatatcctccctgcattcaaccaaaccaccacagtctagatcatatacttcnnnnnnncg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
43298526 |
tttggtgttaatggaattgtatttctagagtaaaaacctctatatcctccctgcattcaaccaaaccaccgcagtctagatcatatacttcaaaaaaacg |
43298625 |
T |
|
| Q |
111 |
acgtcaagaaaattggacattgtaaaattatgcatacccctattcccaaaactttttgcactccatacatatggtataagccacaaact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43298626 |
acgtcaagaaaattggacattgtaaaattatgcatacccctattcccaaaactttttgcactccatacatatggtataagccacaaact |
43298714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University