View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7708_low_59 (Length: 206)
Name: NF7708_low_59
Description: NF7708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7708_low_59 |
 |  |
|
| [»] scaffold0177 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 35 - 191
Target Start/End: Original strand, 42949371 - 42949527
Alignment:
| Q |
35 |
tatcttgggttattgactcactcatgtacatgttttgagagtttgaacctcggtccccgtaactcattttcaacaattttaattttgatattcaattatc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42949371 |
tatcttgggttattgactcactcatgtacatgttttgagagtttgaacctcggtccccgtaactcattttcaacaattttaattttgatattcaattatc |
42949470 |
T |
 |
| Q |
135 |
tgcacgaggcaagagctttatctcttgagggttgttttcaatttatcacttgttctt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42949471 |
tgcacgaggcaagagctttatctcttgagggttgttttcaatttatcacttgttctt |
42949527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 151 - 191
Target Start/End: Original strand, 42949552 - 42949592
Alignment:
| Q |
151 |
tttatctcttgagggttgttttcaatttatcacttgttctt |
191 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42949552 |
tttatcttttgagggttgttttcaatttatcacttgttctt |
42949592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 35 - 188
Target Start/End: Original strand, 2851171 - 2851322
Alignment:
| Q |
35 |
tatcttgggttattgactc-actcatgtacatgttttgagagtttgaacctcggtccccgtaactcattttcaacaattttaattttgatattcaattat |
133 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2851171 |
tatcttgggttattgactccactcatgtacatgttttgagagtttgaacctcagtccccataactcattttcaacaattttaaatttgatattcaattat |
2851270 |
T |
 |
| Q |
134 |
ctgcacgaggcaagagctttatctcttgagggttgttttcaatttatcacttgtt |
188 |
Q |
| |
|
|||||| || ||| | |||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
2851271 |
ctgcacaagtcaaaatctttatctcttgtgg---gttttcaatttctcacttgtt |
2851322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 35 - 188
Target Start/End: Original strand, 2903203 - 2903354
Alignment:
| Q |
35 |
tatcttgggttattgactc-actcatgtacatgttttgagagtttgaacctcggtccccgtaactcattttcaacaattttaattttgatattcaattat |
133 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2903203 |
tatcttgggttattgactccactcatgtacatgttttgagagtttgaacctcagtccccataactcattttcaacaattttaaatttgatattcaattat |
2903302 |
T |
 |
| Q |
134 |
ctgcacgaggcaagagctttatctcttgagggttgttttcaatttatcacttgtt |
188 |
Q |
| |
|
|||||| || ||| | |||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
2903303 |
ctgcacaagtcaaaatctttatctcttgtgg---gttttcaatttctcacttgtt |
2903354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0177 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0177
Description:
Target: scaffold0177; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 1831 - 1864
Alignment:
| Q |
1 |
ccttatgtcttctgtcgttacctctattggtcct |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
1831 |
ccttatgtcttctgtcgttacctcttttggtcct |
1864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 30222722 - 30222755
Alignment:
| Q |
1 |
ccttatgtcttctgtcgttacctctattggtcct |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
30222722 |
ccttatgtcttctgtcgttacctcttttggtcct |
30222755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 36673876 - 36673843
Alignment:
| Q |
1 |
ccttatgtcttctgtcgttacctctattggtcct |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
36673876 |
ccttatgtcttctgtcgttacctcttttggtcct |
36673843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 41126315 - 41126348
Alignment:
| Q |
1 |
ccttatgtcttctgtcgttacctctattggtcct |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
41126315 |
ccttatgtcttctgtcgttacctcttttggtcct |
41126348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 2138677 - 2138644
Alignment:
| Q |
1 |
ccttatgtcttctgtcgttacctctattggtcct |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
2138677 |
ccttatgtcttctgtcgttacctcttttggtcct |
2138644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 53047973 - 53048006
Alignment:
| Q |
1 |
ccttatgtcttctgtcgttacctctattggtcct |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
53047973 |
ccttatgtcttctgtcgttacctcttttggtcct |
53048006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 53049077 - 53049044
Alignment:
| Q |
1 |
ccttatgtcttctgtcgttacctctattggtcct |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
53049077 |
ccttatgtcttctgtcgttacctcttttggtcct |
53049044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 2238018 - 2237985
Alignment:
| Q |
1 |
ccttatgtcttctgtcgttacctctattggtcct |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
2238018 |
ccttatgtcttctgtcgttacctcttttggtcct |
2237985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 35684243 - 35684210
Alignment:
| Q |
1 |
ccttatgtcttctgtcgttacctctattggtcct |
34 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
35684243 |
ccttatgtcttctgtcgttacctcttttggtcct |
35684210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 34
Target Start/End: Complemental strand, 73025 - 72993
Alignment:
| Q |
2 |
cttatgtcttctgtcgttacctctattggtcct |
34 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
73025 |
cttatgtcttctgtcgttacctcttttggtcct |
72993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University