View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7709_high_15 (Length: 201)
Name: NF7709_high_15
Description: NF7709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7709_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 36 - 188
Target Start/End: Complemental strand, 4560473 - 4560321
Alignment:
| Q |
36 |
gttttgttaggaacaaatcatttgtattttaggtcttgctatgttcttaagtatgatacattgctgttcatacttcgaagtaagacaatacttcaaaatc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4560473 |
gttttgttaggaacaaatcatttgtattttaggtcttgctatgttcttaagtatggtacattgctgttcatacttcgaagtaagacaatacttcaaaatc |
4560374 |
T |
 |
| Q |
136 |
ataataatattaaatttatattcttctttagctcgtttataaaatttctctgc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4560373 |
ataataatattaaatttatattcttctttagctcgtttataaaatttctctgc |
4560321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 113 - 188
Target Start/End: Complemental strand, 4574090 - 4574015
Alignment:
| Q |
113 |
aagtaagacaatacttcaaaatcataataatattaaatttatattcttctttagctcgtttataaaatttctctgc |
188 |
Q |
| |
|
||||||||||||| || ||||||||| |||||||| |||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
4574090 |
aagtaagacaatagttgaaaatcatattaatattatatttatattcttcttttgatcttttataaaatttctctgc |
4574015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 36 - 91
Target Start/End: Complemental strand, 4574275 - 4574220
Alignment:
| Q |
36 |
gttttgttaggaacaaatcatttgtattttaggtcttgctatgttcttaagtatga |
91 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
4574275 |
gttttgttaggaacaaataattcatattttaggtcttcctatgttcttaagtatga |
4574220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University