View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7709_low_25 (Length: 251)
Name: NF7709_low_25
Description: NF7709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7709_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 39032897 - 39032693
Alignment:
| Q |
18 |
agatctaaattggtggacatcatgggtggttggataaaaaagaaagagttgattaattgtagttgcaatnnnnnnnnctagcaacaaggtcgtcatcttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39032897 |
agatctaaattggtggacatcatgggtggttggataaaaaagaaagagtcgatt----gtagttgcaataaaaaaa-ctagcaacaaggtcgtcatcttt |
39032803 |
T |
 |
| Q |
118 |
ttgctagaaaatatgtcgagagaagtagcattatccttaaaattaacaagattgttaacttcattcaagaacaagccatacgctaatccataataacagt |
217 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39032802 |
ttgctagaaa-tatgtcgcgagaagtagcattatccttaaaattaacaagattgttaacttcattcaagaacaagccatacgctaatccataataacact |
39032704 |
T |
 |
| Q |
218 |
ttttacctcat |
228 |
Q |
| |
|
||| ||||||| |
|
|
| T |
39032703 |
tttaacctcat |
39032693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University