View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7709_low_26 (Length: 243)
Name: NF7709_low_26
Description: NF7709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7709_low_26 |
 | |
|
| [»] chr6 (4 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 12 - 243
Target Start/End: Original strand, 15440908 - 15441139
Alignment:
| Q |
12 |
catcatatttttcttaacatgaagcttttgcattttacgaagttggaagcttttgccatcgcagtgtttcacattctaaaatacctttttgtccttgtac |
111 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15440908 |
catcatatttttcttaacgtgaagcttttgcattttacgaagttggaagcttttgccattacagtgtttcacattctaaaatacctttttgtccttgtac |
15441007 |
T |
|
| Q |
112 |
acctcaacatccccttttcaggtattgtttagacgggcctgtaatttttacggatgaggttatttggttttgcgaggactgcgaaacagatgtagtagtc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15441008 |
acctcaacatccccttttcaggtattgtttagacgggcctgtaatttttacggatgaggttatttggttttgcgaggactgcgaaacagatgtagtagtc |
15441107 |
T |
|
| Q |
212 |
ataaatgactctgatagtgagtcgacagattc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15441108 |
ataaatgactctgatagtgagtcgacagattc |
15441139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 108 - 180
Target Start/End: Complemental strand, 15281753 - 15281682
Alignment:
| Q |
108 |
gtacacctcaacatccccttttcaggtattgtttagacgggcctgtaatttttacggatgaggttatttggtt |
180 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15281753 |
gtacacctcaacatccacttt-caggtattgtttagacgggcctgtcatttttacggatgaggttatttggtt |
15281682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 109 - 183
Target Start/End: Complemental strand, 11779337 - 11779263
Alignment:
| Q |
109 |
tacacctcaacatccccttttcaggtattgtttagacgggcctgtaatttttacggatgaggttatttggttttg |
183 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
11779337 |
tacacctcatcacccccttttcaggtattgtttagacgggcctgtgatttttacagaagaggttatttggttttg |
11779263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 123 - 189
Target Start/End: Complemental strand, 11788814 - 11788748
Alignment:
| Q |
123 |
cccttttcaggtattgtttagacgggcctgtaatttttacggatgaggttatttggttttgcgagga |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
11788814 |
cccttttcaggtattgtttagacgggcctgtgatttttacggatgaggttatttggtattgtgagga |
11788748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 501823 - 501735
Alignment:
| Q |
104 |
ccttgtacacctcaacatccccttttcaggtattgtttagacgggcctgtaatttttacggatgaggttatttggttttgcgaggactg |
192 |
Q |
| |
|
|||| ||||| ||||| || ||||||| ||||||||||||| |||||||| |||||||| |||||||| ||||| |||| || ||||| |
|
|
| T |
501823 |
ccttatacacttcaacttctccttttcgggtattgtttagatgggcctgtgatttttacatatgaggttttttggctttgtgatgactg |
501735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 127 - 201
Target Start/End: Original strand, 44805138 - 44805212
Alignment:
| Q |
127 |
tttcaggtattgtttagacgggcctgtaatttttacggatgaggttatttggttttgcgaggactgcgaaacaga |
201 |
Q |
| |
|
||||||||| ||||||||||| ||||| |||||||| ||||| || || |||||||| |||||||| ||| |||| |
|
|
| T |
44805138 |
tttcaggtactgtttagacggacctgtgatttttaccgatgaagtgatatggttttgtgaggactgtgaaccaga |
44805212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University